The EZH2-NEAT1 epigenetic axis promotes cuproptosis sensitivity and modulates cancer cell migration in colorectal cancer
Highlight box
Key findings
• Enhancer of zeste homolog 2 (EZH2) and NEAT1 are jointly upregulated during copper-induced cell death in colorectal cancer (CRC) cells.
• EZH2 transcriptionally activates NEAT1 by maintaining H3K27 acetylation at the NEAT1 promoter, demonstrating a non-canonical activating function.
What is known, and what is new?
• EZH2 is frequently overexpressed in CRC and is a key epigenetic regulator, while cuproptosis represents a promising therapeutic strategy for CRC.
• The EZH2-NEAT1 axis functions as a pro-death pathway that transcriptionally regulates cuproptosis sensitivity by modulating dihydrolipoamide S-acetyltransferase aggregation and proteotoxic stress, and its expression level could serve as a biomarker for copper-based therapies.
What is the implication, and what should change now?
• Elevated EZH2-NEAT1 expression may serve as a biomarker for identifying patients likely to respond to copper-based therapies.
Introduction
As the third most commonly diagnosed cancer and the second leading cause of cancer-related death worldwide, colorectal cancer (CRC) is one of the most prevalent and lethal malignancies (1,2). In 2023, approximately 153,020 individuals were diagnosed with CRC in the United States alone, and 52,550 died from the disease (3). Despite significant advances in surgical techniques, chemotherapy, and targeted therapies, the five-year survival rate for metastatic CRC remains below 15%, highlighting an urgent need for novel therapeutic strategies (4). Recent efforts have focused on exploiting metabolic vulnerabilities and inducing alternative cell death pathways in cancer cells to overcome resistance to conventional therapies (5-7).
Cuproptosis, a recently discovered form of regulated cell death, represents a promising therapeutic avenue for the treatment of cancer (8). Unlike apoptosis, ferroptosis, or pyroptosis, cuproptosis is uniquely triggered by copper ionophores such as elesclomol in the presence of excess copper, leading to the direct binding of copper to lipoylated components of the tricarboxylic acid (TCA) cycle. This copper binding induces the aggregation of lipoylated dihydrolipoamide S-acetyltransferase (DLAT) and subsequent loss of iron-sulfur cluster proteins, ultimately resulting in proteotoxic stress and cell death (8). Due to its dependence on mitochondrial respiration, the role of cuproptosis is particularly important in cancer cells with high metabolic demands. Ferredoxin 1 (FDX1), a protein involved in the reduction of Cu2+ to the more toxic Cu+ form, has been identified as a critical upstream regulator of cuproptosis (8,9). Recent studies have demonstrated the potential of cuproptosis-based therapies in CRC, with copper-based nanoparticles and combination strategies showing promising preclinical results (10,11). However, the molecular mechanisms governing cuproptosis sensitivity in cancer cells remain largely unexplored, particularly the role of epigenetic regulation.
Enhancer of zeste homolog 2 (EZH2), the catalytic subunit of polycomb repressive complex 2 (PRC2), is a histone methyltransferase that catalyzes the trimethylation of histone H3 lysine 27 (H3K27me3), leading to the transcriptional repression of target genes (12-14). EZH2 is frequently overexpressed in various cancers, including CRC, where its expression has been shown to be correlated with advanced tumor stage, metastasis, and a poor prognosis (15,16). Beyond its canonical role as a transcriptional repressor, emerging evidence suggests that EZH2 can also function as a transcriptional activator through methyltransferase-independent mechanisms (17). Recent studies have shown that EZH2 can maintain histone H3 lysine 27 acetylation (H3K27ac) to promote gene transcription in certain contexts, challenging the traditional view that EZH2 is solely a repressive regulator (17,18). The dual functionality of EZH2 in both gene silencing and activation suggests that it may play complex roles in cellular stress responses beyond its well-characterized functions in cancer development and progression.
Given the emerging role of cuproptosis as a potential therapeutic strategy and the multifaceted functions of EZH2 in cancer biology and stress responses, we sought to investigate whether CRC cells are susceptible to cuproptosis and to identify key epigenetic regulatory factors that modulate this sensitivity. In this study, we first established a cuproptosis model in CRC cell lines using the copper ionophore elesclomol in combination with copper chloride. Through the characterization of the cuproptosis response, we observed that EZH2 expression was significantly upregulated during copper-induced cell death, suggesting a potential regulatory role. Functional investigations showed that EZH2 knockdown protected cells from copper-induced death and EZH2 overexpression enhanced cell death sensitivity, revealing that EZH2 promotes cuproptosis sensitivity in CRC cells. To elucidate the mechanism by which EZH2 regulates cuproptosis, we explored potential downstream effectors and identified the long non-coding RNA (lncRNA) NEAT1 as a critical mediator of the pro-death effects of EZH2. We demonstrated that EZH2 transcriptionally activates NEAT1, which in turn modulates cuproptosis sensitivity by regulating proteotoxic stress responses and lipoylated protein homeostasis. Further, we showed that the EZH2-NEAT1 axis regulates both cuproptosis sensitivity through cell-autonomous mechanisms and tumor microenvironment modulation through extracellular NEAT1-mediated effects on cancer cell migration in macrophage co-culture systems, demonstrating that the EZH2-NEAT1 pathway functions as part of the cuproptosis execution machinery and also modulates the tumor microenvironment through extracellular NEAT1-mediated effects—findings that have broader implications for cancer progression and immune evasion. The aim of this study is to elucidate a novel epigenetic mechanism that controls cuproptosis in CRC. We will validate and define the EZH2-NEAT1 pathway as a key component of the cuproptosis execution machinery. We expect that this work will demonstrate that tumors with elevated EZH2-NEAT1 expression exhibit enhanced sensitivity to copper-based therapies. Concurrently, we will systematically evaluate the effects of targeting this pathway on tumor migration. The intended outcome is to provide a comprehensive efficacy and risk assessment for future combination treatment strategies targeting this pathway, ultimately guiding its clinical translation. We present this article in accordance with the MDAR reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1058/rc).
Methods
Cell lines and cell cultures
The human CRC cell lines HCT116 and RKO were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The HCT116 cells were cultured in McCoy’s 5A Medium (Gibco, Waltham, MA, USA, 16600-082) supplemented with 10% fetal bovine serum (FBS; Gibco, 10270-106) and 1% penicillin-streptomycin (Gibco, 15140-122). The RKO cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM; Hyclone, Logan, Utah, USA, SH30243.01) supplemented with 10% FBS and 1% penicillin-streptomycin. All the cells were maintained at 37 ℃ in a humidified incubator with 5% CO2. The cell lines were authenticated by short tandem repeat (STR) profiling and tested negative for mycoplasma contamination.
Reagents and antibodies
Elesclomol (SML0583) and copper chloride (CuCl2, 203149) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Stock solutions of elesclomol (10 mM) were prepared in dimethyl sulfoxide (DMSO; Sigma-Aldrich, D2650) and stored at −20 ℃. Copper chloride was dissolved in sterile water at 10 mM and stored at 4 ℃. For the cuproptosis induction experiments, elesclomol and CuCl2 were used at a 1:1 molar ratio unless otherwise specified. The following primary antibodies were used: anti-EZH2 (Cell Signaling Technology, Danvers, MA, USA, 5246S), anti-HSP70 (Cell Signaling Technology, 4872S), anti-DLAT (Proteintech, Wuhan, China, 16179-1-AP), anti-FDX1 (Abcam, Cambridge, MA, USA, ab206649), anti-LIAS (Proteintech, 14812-1-AP), anti-lipoic acid (Calbiochem, San Diego, CA, USA, 437695), anti-β-actin (Sigma-Aldrich, A2228) and anti-HA tag (Cell Signaling Technology, 3724S). The following secondary antibodies were used: horseradish peroxidase (HRP)-conjugated anti-rabbit immunoglobulin G (IgG) (Cell Signaling Technology, 7074S) and anti-mouse IgG (Cell Signaling Technology, 7076S). The other reagents used included: Lipofectamine 3000 Transfection Reagent (Thermo Fisher Scientific, Waltham, MA, USA, L3000015), Lipofectamine RNAiMAX (Thermo Fisher Scientific, 13778075), puromycin (Sangon Biotech, Shanghai, China, A610593), polybrene (Sigma-Aldrich, H9268), protease inhibitor cocktail (Roche, Basel, Switzerland, 11836170001), and phosphatase inhibitor cocktail (Roche, 04906837001).
Plasmids and lentiviral constructs
Human EZH2 complementary DNA was amplified from the HCT116 cells and cloned into the pLVX-IRES-puro vector (Clontech, Mountain View, CA, USA, 632183) with an N-terminal HA tag. The human NEAT1 full-length transcript was amplified and cloned into pCDH-CMV-MCS-EF1-copGFP (System Biosciences, Palo Alto, CA, USA, CD511B-1). Empty vectors served as the controls. All constructs were verified by DNA sequencing. For knockdown, small interfering RNAs (siRNAs) targeting EZH2 and NEAT1 as well as their negative control siRNAs were synthesized by GenePharma (Shanghai, China). The cells were transfected with 50 nM of siRNA using Lipofectamine RNAiMAX (Invitrogen, Thermo Fisher Scientific) in accordance with the manufacturer’s instructions.
Lentivirus production and stable cell line generation
The lentiviruses were produced by transfecting HEK293T cells (ATCC, CRL-3216) with the transfer plasmid along with the packaging plasmids psPAX2 (Addgene, Watertown, MA, USA, 12260) and pMD2.G (Addgene, 12259) using Lipofectamine 3000 in accordance with the manufacturer’s instructions. The viral supernatants were collected at 48 and 72 hours post-transfection, filtered through 0.45-µm filters (Millipore, Billerica, MA, USA, SLHV033RS), and concentrated using Lenti-X Concentrator (Takara, Kusatsu, Shiga, Japan, 631232). For stable cell line generation, the HCT116 and RKO cells were infected with the lentivirus in the presence of 8 µg/mL of polybrene. After 24 hours, the medium was replaced, and cells were subjected to selection with 2 µg/mL of puromycin (for HCT116) or 1.5 µg/mL of puromycin (for RKO) for 5–7 days. Knockdown or overexpression efficiency was confirmed by Western blot and real-time quantitative polymerase chain reaction (RT-qPCR).
Cell viability assays
Cell viability was assessed using the Cell Counting Kit-8 (CCK-8; Dojindo, Kumamoto, Japan, CK04) in accordance with the manufacturer’s instructions. Briefly, the cells were seeded in 96-well plates at 5,000 cells per well and allowed to attach overnight. The cells were then treated with indicated concentrations of elesclomol with or without CuCl2 for specified time periods. CCK-8 solution (10 µL) was added to each well and incubated for 2 hours at 37 ℃. Absorbance was measured at 450 nm using a microplate reader (BioTek Synergy H1, Biotek Winooski, Vermont, USA). Cell viability was calculated as a percentage relative to the vehicle-treated control cells. Each condition was performed in quintuplicate, and experiments were repeated at least three times independently.
Colony formation assays
The cells were seeded in six-well plates at 500–1,000 cells per well and allowed to attach overnight. The cells were then treated with elesclomol (100 nM) with or without CuCl2 (100 nM) for indicated time periods. After treatment, the medium was replaced with fresh complete medium, and the cells were cultured for an additional 10–14 days with medium changes every 3 days. Colonies were fixed with 4% paraformaldehyde (Sigma-Aldrich, P6148) for 15 minutes, stained with 0.1% crystal violet (Sigma-Aldrich, C0775) for 30 minutes, and washed with distilled water. Colonies containing >50 cells were counted using. ImageJ software (version 1.53, National Institutes of Health, Bethesda, MD, USA). The experiments were performed in triplicate and repeated three times independently.
Western blot analysis
The cells were lysed in radioimmunoprecipitation assay (RIPA) buffer (Beyotime, Shanghai, China, P0013B) containing protease and phosphatase inhibitor cocktails on ice for 30 minutes. The lysates were centrifuged at 12,000 ×g for 15 minutes at 4 ℃, and the supernatants were collected. Protein concentration was determined using the bicinchoninic acid (BCA) Protein Assay Kit (Thermo Fisher Scientific, 23225). Equal amounts of protein (20–40 µg) were separated by 10% or 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, IPVH00010). The membranes were blocked with 5% non-fat milk (Bio-Rad, Hercules, CA, USA, 1706404) in TBST (Tris-buffered saline with 0.1% Tween-20) for 1 hour at room temperature, then incubated with primary antibodies (1:1,000 dilution) overnight at 4 ℃. After washing with TBST, the membranes were incubated with HRP-conjugated secondary antibodies (1:5,000 dilution) for 1 hour at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL) substrate (Millipore, WBKLS0500) and detected with a ChemiDoc Imaging System (Bio-Rad). Band intensities were quantified using ImageJ software and normalized to loading controls (β-actin).
Soluble and insoluble protein fractionation
To analyze the DLAT protein aggregation, the cells were lysed in fractionation buffer containing 1% Triton X-100 (Sigma-Aldrich, T8787), 50 mM of Tris-HCl pH 7.4, 150 mM of NaCl, and 1 mM of ethylenediaminetetraacetic acid (EDTA), supplemented with protease and phosphatase inhibitors. The lysates were incubated on ice for 20 minutes and centrifuged at 15,000 ×g for 20 minutes at 4 ℃. The supernatant was collected as the soluble fraction. The pellet (insoluble fraction) was washed three times with fractionation buffer, then resuspended in RIPA buffer containing 1% SDS and sonicated briefly. Both fractions were analyzed by Western blot. Equal volumes or protein amounts from soluble and insoluble fractions were loaded for comparison.
RNA extraction and RT-qPCR
Total RNA was extracted using TRIzol Reagent (Invitrogen, 15596018) in accordance with the manufacturer’s instructions. RNA concentration and purity were measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific). One microgram of total RNA was reverse transcribed using the PrimeScript RT Reagent Kit (Takara, RR037A). Quantitative polymerase chain reaction (qPCR) was performed using SYBR Green PCR Master Mix (Takara, RR420A) on a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The cycling conditions were: 95 ℃ for 30 seconds, followed by 40 cycles of 95 ℃ for 5 seconds and 60 ℃ for 34 seconds. The gene expression levels were calculated using the 2−ΔΔCt method and normalized to 18S or β-actin as internal controls. The primer sequences used are listed below (Table 1). Each sample was analyzed in triplicate, and the experiments were repeated three times independently.
Table 1
| Name | Forward-primer (5'-3') | Reverse-primer (5'-3') |
|---|---|---|
| EZH2 | GACCTCTGTCTTACTTGTGGAGC | CGTCAGATGGTGCCAGCAATAG |
| NEAT1 | ATGCCACAACGCAGATTGAT | CGAGAAACGCACAAGAAGG |
| β-actin | CACCATTGGCAATGAGCGGTTC | AGGTCTTTGCGGATGTCCACGT |
| 18S | CTACCACATCCAAGGAAGC | TTTTTCGTCACTACCTCCCCG |
qPCR, quantitative polymerase chain reaction.
Extracellular NEAT1 quantification and CRC cell migration assays with macrophage co-cultures
To assess the extracellular NEAT1 levels, conditioned medium was collected from the HCT116 and RKO cells with various EZH2 and NEAT1 manipulations after 48 hours of culture in serum-free medium. The culture supernatants were centrifuged at 2,000 ×g for 10 minutes to remove cellular debris, and extracellular NEAT1 RNA was extracted using TRIzol LS Reagent (Invitrogen, 10296028) in accordance with the manufacturer’s instructions. The NEAT1 levels were quantified by RT-qPCR and normalized to the volume of the conditioned medium.
For the CRC cell migration assays in the context of the macrophage co-culture systems, RAW264.7 murine macrophages (ATCC, TIB-71) or human THP-1-derived macrophages were used. CRC cell migration was assessed using 24-well Transwell chambers with 8-µm pore polycarbonate membrane inserts (Corning, Corning, NY, USA, 3422). Engineered CRC cells (HCT116 or RKO cells with various EZH2 and NEAT1 manipulations; 5×104 cells in 200 µL serum-free medium) were seeded into the upper chamber. Macrophages (5×104 cells) were seeded in the lower chamber in 600 µL of complete medium. After 24 hours of incubation at 37 ℃, the non-migrated CRC cells on the upper surface of the membrane were removed with cotton swabs. The CRC cells that migrated to the lower surface were fixed with 4% paraformaldehyde for 15 minutes and stained with 0.1% crystal violet for 30 minutes. The migrated CRC cells were photographed under a light microscope (Olympus, Tokyo, Japan) and counted in five random fields per insert at 200× magnification. The experiments were performed in triplicate and repeated three times independently.
Bioinformatics analysis
A correlation analysis between EZH2 and cuproptosis-related genes was performed using The Cancer Genome Atlas (TCGA) colorectal adenocarcinoma dataset accessed through the University of California Santa Cruz (UCSC) Xena platform (https://xenabrowser.net). The gene expression (RNA-sequencing) data were log2-transformed, and Pearson correlation coefficients were calculated. Heatmaps were generated using the “pheatmap” package in R (version 4.2.0). Cuproptosis-related genes were identified based on recent literature and included: FDX1, LIPT1, LIAS, DLD, DLAT, DLST, ATP7A, ATP7B, SLC31A1, CDKN2A, GLS, and MTF1. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Statistical analysis
All the data are presented as the mean ± standard deviation (SD) from at least three independent experiments unless otherwise stated. The statistical analyses were performed using GraphPad Prism 9 (GraphPad Software, San Diego, CA, USA). Comparisons between two groups were analyzed using the unpaired two-tailed Student’s t-test. Multiple group comparisons were analyzed by one-way analysis of variance followed by Tukey’s post-hoc test. Statistical significance was defined as: *, P<0.05; **, P<0.01; ***, P<0.001; P values <0.05 were considered statistically significant.
Results
Elesclomol-copper complex induces cuproptosis in CRC cells through proteotoxic stress and lipoylated protein aggregation
To investigate cuproptosis in CRC, we first established a copper-dependent cell death model using two CRC cell lines, HCT116 and RKO. Treatment with elesclomol alone (up to 400 nM) for 48 hours showed minimal cytotoxicity, with cell viability remaining high in both cell lines (Figure 1A). Conversely, the combination of elesclomol with copper chloride (Elsm-Cu) induced dose-dependent cell death in both the HCT116 and RKO cells (Figure 1B). Based on these dose-response curves, 100 nM of Elsm-Cu was used for the subsequent experiments. Colony formation assays demonstrated that 100 nM of Elsm alone permitted robust colony growth similar to the controls at 48 hours, while the Elsm-Cu treatment at the same concentration severely impaired colony formation in both the HCT116 and RKO cells (Figure 1C,1D). To confirm cuproptosis induction, we examined established biomarkers. The Western blot analysis showed that HSP70 was upregulated in the Elsm-treated cells, and even further elevated in both the Elsm-Cu-treated HCT116 and RKO cells (Figure 1E,1F). Critically, the DLAT distribution analysis revealed that while the Elsm treatment alone caused minimal change, it caused substantial DLAT accumulation in the insoluble fraction with a corresponding depletion from the soluble fraction in both cell lines (Figure 1G-1J). This shift from soluble to insoluble DLAT represents the characteristic protein aggregation hallmark of cuproptosis.
EZH2 expression is upregulated during copper-induced cell death and promotes cuproptosis sensitivity
To identify potential epigenetic regulators of cuproptosis, we performed a bioinformatic analysis and a heatmap analysis that revealed significant positive correlations between EZH2 and multiple cuproptosis genes, including ATP7A, ATP7B, CDKN2A, and DLAT (Figure 2A). The Western blot analysis demonstrated dose-dependent EZH2 protein upregulation in both the HCT116 and RKO cells, with progressive increases from 10 to 400 nM in both the Elsm and Elsm-Cu treatments, but stronger induction with Elsm-Cu (Figure 2B). This upregulation pattern suggests that EZH2 might be part of the cuproptosis execution machinery rather than a protective stress response.
To investigate the functional role of EZH2 in cuproptosis, we generated stable knockdown lines using two independent siRNAs, with qPCR and Western blot confirming effective EZH2 reduction (Figure 2C,2D). Notably, the EZH2 knockdown cells exhibited resistance to the Elsm-Cu treatment, showing improved cell viability (Figure 2E) and increased colony formation compared to the control cells (Figure 2F). The Western blot analysis revealed that the EZH2 knockdown cells showed reduced HSP70 levels under both the basal and Elsm-Cu treatment conditions compared to the controls (Figure 2G), indicating decreased proteotoxic stress. The DLAT fractionation analysis demonstrated reduced DLAT accumulation in the insoluble fraction and better retention in the soluble fraction in the Si-EZH2 cells compared to the controls in both the HCT116 and RKO cells (Figure 2H,2I). These results indicate that EZH2 loss protects cells from cuproptosis by reducing proteotoxic stress and preventing DLAT aggregation, suggesting that EZH2 functions as a pro-death factor that promotes cuproptosis rather than conferring resistance.
EZH2 overexpression enhances cuproptosis sensitivity via increased proteotoxic stress
To confirm the pro-death role of EZH2 in cuproptosis, we generated stable EZH2-overexpressing lines. RT-qPCR and Western blot confirmed robust EZH2 upregulation in both the HCT116 and RKO cells compared to the empty vector controls (Figure 3A,3B). EZH2 overexpression significantly reduced cell viability under the Elsm-Cu treatment across all time points (0–48 hours) compared to the control cells (Figure 3C), demonstrating that elevated EZH2 levels sensitize cells to copper-induced death. Colony formation assays showed a significantly impaired colony-forming capacity in the EZH2-overexpressing cells following cuproptosis induction (Figure 3D), confirming that EZH2 overexpression promotes cell death. The Western blot analysis revealed that EZH2 overexpression increased HSP70 levels compared to the control cells under the Elsm-Cu treatment (Figure 3E), indicating elevated proteotoxic stress. DLAT fractionation demonstrated increased DLAT accumulation in the insoluble fraction with corresponding depletion from the soluble fraction in the EZH2-overexpressing cells compared to the controls in both cell lines (Figure 3F,3G). These molecular changes confirm that EZH2 overexpression exacerbates cuproptosis-associated proteotoxic stress and enhances the characteristic DLAT aggregation that drives copper-induced cell death.
EZH2 regulation of cuproptosis is independent of FDX1 transcription but involves the modulation of the lipoylation pathway and is correlated with NEAT1 expression
To elucidate the mechanism by which EZH2 promotes cuproptosis, we examined its effects on core cuproptosis machinery. The Western blot analysis showed that EZH2 knockdown reduced lipoylated DLAT levels and increased FDX1 protein expression while maintaining LIAS levels in both the cell lines (Figure 4A). The protection from cuproptosis can be explained by the reduction in lipoylated DLAT, which reduces the substrate available for copper-induced aggregation. Conversely, EZH2 overexpression increased both the lipoylated DLAT and FDX1 protein levels without affecting LIAS (Figure 4B). Elevated lipoylated DLAT provides more substrate for copper-induced aggregation, which explains the enhanced cuproptosis sensitivity. Notably, RT-qPCR revealed no significant changes in FDX1 messenger RNA (mRNA) with either EZH2 knockdown or overexpression (Figure 4C,4D), indicating that EZH2 regulates FDX1 at the post-transcriptional level rather than through transcriptional control. These findings suggest that EZH2 promotes cuproptosis primarily by enhancing the availability of lipoylated DLAT, the critical substrate for copper-induced protein aggregation and cell death.
Given that recent a study has demonstrated the role of EZH2 in regulating the lncRNA NEAT1 in immune cells (15), and that NEAT1 has been implicated in cellular stress responses, we examined whether EZH2 promotes cuproptosis through NEAT1. The NEAT1 expression analysis showed marked changes: EZH2 knockdown reduced NEAT1 levels in both the cell lines, while EZH2 overexpression increased NEAT1 expression (Figure 4E,4F). This regulatory relationship between EZH2 and NEAT1 in CRC cells is consistent with findings in macrophages, where EZH2 was shown to maintain H3K27 acetylation in the NEAT1 promoter, facilitating its transcription. The time-course analysis revealed that NEAT1 expression was maintained at baseline levels with the Elsm treatment alone across all concentrations tested (Figure 4G). However, the Elsm-Cu treatment induced dose-dependent NEAT1 upregulation, resulting in significant elevation in the HCT116 cells and RKO cells (Figure 4H). This coordinated upregulation of both EZH2 (Figure 2B) and NEAT1 during cuproptosis induction supports the model that the EZH2-NEAT1 axis is activated as part of the cuproptosis execution program. The parallel increase in both components of this regulatory axis during copper-induced cell death strongly suggests they function together as pro-death mediators rather than protective stress responses.
NEAT1 mediates EZH2-dependent cuproptosis promotion and acts as a pro-death factor
To determine whether NEAT1 mediates the pro-death effects of EZH2 in cuproptosis, we performed rescue experiments. The NEAT1 expression analysis confirmed successful manipulation: Si-EZH2 alone reduced NEAT1, while combined Si-EZH2 with NEAT1 overexpression partially restored the expression levels. EZH2 overexpression increased NEAT1, while combined EZH2 overexpression with Si-NEAT1 resulted in intermediate expression (Figure 5A,5B). This confirmed the regulatory hierarchy in which EZH2 acts upstream of NEAT1, consistent with the transcriptional mechanism (15). Colony formation assays demonstrated the functional relationship: Si-EZH2 alone showed abundant colony formation under the Elsm-Cu treatment, but NEAT1 co-overexpression significantly reduced colony formation, restoring cuproptosis sensitivity (Figure 5C). This demonstrates that NEAT1 functions as a pro-death factor: reintroducing NEAT1 to the protected Si-EZH2 cells re-sensitized them to copper-induced death. Conversely, EZH2 overexpression alone showed minimal colony formation, which was partially rescued by NEAT1 knockdown, with more colonies surviving (Figure 5C). This confirms that NEAT1 is necessary for EZH2-mediated death promotion: removing NEAT1 from the hypersensitive EZH2-overexpressing cells provides partial protection from cuproptosis. These bidirectional rescue experiments conclusively demonstrate that NEAT1 is both necessary and sufficient to mediate the pro-death effects of EZH2 in cuproptosis.
The Western blot analysis showed that NEAT1 overexpression in the Si-EZH2 cells increased HSP70 levels, restoring proteotoxic stress (Figure 5D). Conversely, NEAT1 knockdown in the EZH2-overexpressing cells reduced HSP70 elevation, alleviating proteotoxic stress (Figure 5D). The DLAT fractionation analysis confirmed these effects at the molecular level: NEAT1 overexpression in the Si-EZH2 cells increased DLAT aggregation in the insoluble fraction, restoring the cuproptosis-associated protein aggregation pattern. Conversely, NEAT1 knockdown in the EZH2-overexpressing cells reduced DLAT accumulation in the insoluble fraction, preventing excessive aggregation (Figure 5E,5F). Importantly, an analysis of the core cuproptosis machinery revealed that these NEAT1 manipulations did not significantly alter the FDX1 protein levels, confirming that the EZH2-NEAT1 axis modulates cuproptosis downstream of copper reduction, primarily by regulating lipoylated protein homeostasis and proteotoxic stress responses (Figure 5G). Taken together, these results establish NEAT1 as the critical downstream effector through which EZH2 promotes cuproptosis in CRC cells.
The EZH2-NEAT1 axis regulates extracellular NEAT1 levels and macrophage recruitment
To investigate whether the EZH2-NEAT1 axis influences tumor-immune cell interactions, we examined the regulation of extracellular NEAT1 and its effect on cancer cell behavior in the presence of macrophages. First, we quantified the extracellular NEAT1 content in culture supernatants from CRC cells with various EZH2 and NEAT1 manipulations. In the HCT116 cells, Si-EZH2-1 significantly reduced the extracellular NEAT1 levels compared to the controls, and this reduction was partially rescued by NEAT1 overexpression (Si-EZH2-1 + NEAT1). Conversely, EZH2 overexpression (EZH2-OE) significantly increased the extracellular NEAT1 content, which was partially reversed by NEAT1 knockdown (EZH2-OE + Si-NEAT1) (Figure 6A). Similar patterns were observed in the RKO cells, with Si-EZH2-1 decreasing and EZH2-OE increasing extracellular NEAT1 levels, and corresponding rescue effects on NEAT1 manipulation (Figure 6B). These results demonstrate that the EZH2-NEAT1 axis regulates not only intracellular NEAT1 but also the levels of extracellular NEAT1 released from cancer cells.
To determine whether these changes in the EZH2-NEAT1 axis affect cancer cell behavior in the tumor microenvironment context, we performed migration assays with CRC cells co-cultured with macrophages. In these experiments, we assessed the migration of CRC cells after co-culture with macrophages. In the HCT116 cells, the Si-EZH2-1 cells showed significantly reduced migration capacity after macrophage co-culture compared to the control cells. This impaired migration was partially restored when NEAT1 was overexpressed in the Si-EZH2-1 background (Si-EZH2-1 + NEAT1). Conversely, the EZH2-overexpressing cells exhibited enhanced migration after macrophage co-culture, which was partially attenuated by NEAT1 knockdown (EZH2-OE + Si-NEAT1) (Figure 6C,6D). Consistent results were obtained with the RKO cells, where Si-EZH2-1 reduced cancer cell migration and EZH2-OE enhanced it in the macrophage co-culture system, with NEAT1 manipulation producing the expected rescue effects (Figure 6E,6F). These results demonstrate that the EZH2-NEAT1 axis influences CRC cell migratory behavior in the context of macrophage interaction, likely through the regulation of extracellular NEAT1 levels. This suggests that the EZH2-NEAT1 pathway has dual functions: it promotes cuproptosis sensitivity through cell-autonomous effects, and may also modulate cancer cell aggressiveness through tumor-macrophage crosstalk in the microenvironment.
Discussion
Cuproptosis represents an emerging frontier in cancer therapy, and CRC has been identified as one of the focal malignancies for cuproptosis research alongside breast, lung, and hepatocellular carcinomas (19,20). Since the landmark discovery by Tsvetkov et al. in 2022 that copper induces cell death by targeting lipoylated TCA cycle proteins (8), research on cuproptosis has increased rapidly, with CRC emerging as a particularly relevant model system (21). Recent systematic reviews have confirmed that CRC cells exhibit significant sensitivity to copper-based interventions, particularly through copper ionophores such as elesclomol (22,23). Our study advances this field by establishing a robust cuproptosis model in CRC cell lines, and critically, by identifying the first epigenetic regulatory mechanism governing cuproptosis sensitivity.
The role of epigenetic modifications in regulating novel forms of cell death has garnered increasing attention. Zhou et al. comprehensively reviewed how epigenetic modifications, including DNA methylation, histone modifications, and non-coding RNAs, regulate pyroptosis, ferroptosis, cuproptosis, and disulfidptosis in cancer (24). While they outlined the general principles of epigenetic control over these cell death modalities, specific molecular mechanisms remained largely unexplored. Our identification of the EZH2-NEAT1 axis as a critical regulator of cuproptosis sensitivity represents a significant mechanistic advance, particularly given that no previous studies have directly linked EZH2 to cuproptosis regulation.
The dual functionality of EZH2—as both a transcriptional repressor through H3K27me3 and a transcriptional activator through H3K27 acetylation—has been well-documented (17,18). Interestingly, our findings revealed that the role of EZH2 in cuproptosis differs from its role in other metabolic death pathways. While Lai et al. demonstrated that EZH2 suppresses ferroptosis in hepatocellular carcinoma through the epigenetic regulation of TFR2 (25), we found that EZH2 promotes cuproptosis in CRC by transcriptionally activating the pro-death lncRNA NEAT1 by maintaining H3K27 acetylation. This suggests tissue-specific and death pathway-specific functions of EZH2 in metabolic cell death regulation. This non-canonical function of EZH2 aligns with the seminal work of Yuan et al., who demonstrated that EZH2 maintains H3K27 acetylation in the NEAT1 promoter to facilitate its transcription in macrophages during inflammasome activation (18). Our study extends this mechanism from immune cells to cancer metabolism, demonstrating that the EZH2-NEAT1 regulatory axis operates across diverse cellular contexts and stress responses.
The involvement of NEAT1 in cancer progression and chemoresistance has been extensively documented (26,27). NEAT1 functions as a scaffold RNA molecule by interacting with EZH2 to influence downstream effector expression, acts as a microRNA sponge, and participates in multiple oncogenic pathways, including Wnt/β-catenin signaling (28,29). Chen et al. showed that NEAT1, regulated by the EGFR pathway, contributes to glioblastoma progression through the WNT/β-catenin pathway by scaffolding EZH2 (30). However, our findings revealed a novel dimension: NEAT1 promotes cuproptosis-induced proteotoxic stress and enhances cell death sensitivity without significantly affecting FDX1 transcription, the key upstream regulator of cuproptosis. This suggests that the EZH2-NEAT1 axis modulates cellular stress response machinery downstream of copper uptake and reduction, potentially via the regulation of protein quality control systems and chaperone networks.
Our observation that the EZH2-NEAT1 axis regulates extracellular NEAT1 levels and macrophage recruitment is particularly noteworthy. Recent evidence indicates that cuproptosis inducers can enhance anti-tumor immune responses and synergize with immunotherapy in CRC (31,32). The finding that EZH2-NEAT1 manipulation affects CRC cell migration in the context of macrophage co-culture systems, suggests that this pathway influences tumor-immune interactions beyond its cell-autonomous effects on cuproptosis sensitivity. This is consistent with recent research showing that exosomal NEAT1 modulates immune cell function in various cancer types (33,34). The dual functionality of the EZH2-NEAT1 axis—promoting metabolic stress-induced death while also enhancing cancer cell migration in the tumor microenvironment—suggests that it coordinates multiple pro-survival and immune evasion programs. This dual role presents a complex picture: while EZH2-high CRCs may be more sensitive to copper-based therapies due to enhanced cuproptosis, they may also exhibit increased migratory capacity through the same pathway, highlighting the multifaceted role of this axis in cancer progression.
Our mechanistic findings provide several important insights. First, EZH2 knockdown reduced lipoylated DLAT levels while EZH2 overexpression increased them, suggesting that EZH2-NEAT1 signaling influences the lipoylation pathway, which is central to cuproptosis susceptibility. The observation that DLAT aggregation—the hallmark of cuproptosis—is reduced by EZH2 knockdown and is enhanced by EZH2 overexpression confirms that this axis directly promotes proteotoxic stress responses. Cells with lower EZH2/NEAT1 levels show reduced DLAT aggregation and improved survival, while those with elevated EZH2/NEAT1 levels show increased aggregation and enhanced cell death. Second, although the EZH2 manipulation affected the FDX1 protein levels, the FDX1 mRNA levels remained unchanged, indicating post-transcriptional regulation. This finding contrasts with recent a study of the lactylation-mediated m6A modification of FDX1 mRNA in gastric cancer cuproptosis (35), suggesting tissue-specific regulatory mechanisms.
The therapeutic implications of our findings are substantial. Wang et al. identified cuproptosis as a novel therapeutic target for overcoming cancer drug resistance, noting that copper-based treatments may provide alternatives for chemotherapy-insensitive tumors (6). Similarly, recent reviews have highlighted copper ionophores and copper complexes-based dynamic therapies as promising strategies (23,36). Our identification of the EZH2-NEAT1 axis as a pro-death mechanism has important therapeutic implications. Since elevated EZH2-NEAT1 expression promotes cuproptosis sensitivity, tumors with high EZH2-NEAT1 levels may be particularly sensitive to copper-based therapies and could be prioritized for such treatments. Conversely, combining EZH2 inhibitors with copper therapy would likely be counterproductive, as EZH2 inhibition would reduce cuproptosis sensitivity and protect cancer cells from copper-induced death. However, the observation that the EZH2-NEAT1 axis also promotes cancer cell migration presents a therapeutic paradox: while high EZH2-NEAT1 tumors may be more responsive to copper-based killing, they may also be more metastatic. This suggests that copper-based therapies might be most effective in EZH2-high tumors when combined with anti-metastatic agents rather than with EZH2 inhibitors. Alternatively, the timing and sequence of targeting the EZH2-NEAT1 axis versus copper therapy may be critical considerations for clinical translation.
Several limitations of our study warrant acknowledgment. First, our investigations were conducted exclusively in cell culture models using the HCT116 and RKO cell lines. While these are well-established CRC models, the heterogeneity of human CRC may limit the generalizability of our findings. Validation in additional CRC cell lines with diverse genetic backgrounds and in patient-derived organoids would strengthen the clinical relevance of our observations. Second, we did not perform in vivo experiments to validate the functional significance of the EZH2-NEAT1 axis in cuproptosis regulation using xenograft or orthotopic tumor models. Such studies are essential to assess whether targeting this axis enhances the efficacy of copper-based therapies in a physiologically relevant tumor microenvironment. Third, while we identified NEAT1 as a critical mediator of the pro-death functions of EZH2, the precise molecular mechanisms by which NEAT1 modulates proteotoxic stress and lipoylated protein homeostasis remain incompletely defined. Future studies employing RNA immunoprecipitation sequencing and comprehensive proteomic analyses could elucidate the specific protein partners and downstream effectors through which NEAT1 exerts its cytoprotective functions. Fourth, our study did not investigate the potential involvement of other epigenetic regulators or lncRNAs that might contribute to cuproptosis regulation. Recent research has identified multiple lncRNAs involved in various forms of metabolic cell death (24), and comprehensive screening approaches might reveal additional regulatory nodes. Fifth, while we demonstrated that the EZH2-NEAT1 axis regulates extracellular NEAT1 levels and macrophage recruitment in vitro, we did not comprehensively characterize its effect on the tumor microenvironment in vivo. The precise mechanisms of NEAT1 secretion or release, whether through exosomes or other pathways, remain to be elucidated. Additionally, we only examined macrophage recruitment and did not assess the effects of the EZH2-NEAT1 axis on other immune cell types, polarization states (M1 versus M2 macrophages), or functional outcomes of macrophage infiltration. The broader effects of the EZH2-NEAT1 axis on tumor-immune interactions, including its effects on T cells, natural killer cells, and immunosuppressive myeloid populations, warrants comprehensive investigation in appropriate in vivo models. Finally, while our bioinformatic analyses using TCGA data revealed correlations between EZH2 and cuproptosis-related genes, we did not comprehensively analyze clinical samples to determine whether EZH2 or NEAT1 expression levels were correlated with patient outcomes or treatment responses in CRC.
In conclusion, this study provides the first evidence that the EZH2-NEAT1 epigenetic axis serves as a critical regulator of cuproptosis sensitivity in CRC. We demonstrated that EZH2 transcriptionally activates NEAT1 by maintaining H3K27 acetylation at its promoter, extending the mechanism identified by Yuan et al. in immune cells to cancer metabolism (18). NEAT1, in turn, functions as a pro-death mediator that enhances proteotoxic stress responses and promotes lipoylated DLAT aggregation, thereby sensitizing cells to copper-induced cell death. The coordinated upregulation of both EZH2 and NEAT1 during cuproptosis induction, along with the functional rescue experiments, conclusively demonstrate that this axis is part of the cuproptosis execution machinery rather than a protective stress response. Importantly, this regulatory axis also influences the tumor microenvironment by regulating extracellular NEAT1 levels and CRC cell migratory behavior in macrophage co-culture systems, suggesting that it plays a dual role by both promoting cell death and potentially enhancing metastatic capacity. Our findings reveal that tumors with elevated EZH2-NEAT1 expression may be particularly sensitive to copper-based therapies, providing a potential biomarker for patient selection in future clinical trials of cuproptosis-inducing agents. However, the dual role of this axis in both death sensitivity and migration highlights the need for combination strategies that address both aspects of this pathway’s function. As the field of cuproptosis-based cancer therapy continues to evolve (24,37), understanding how epigenetic regulators like EZH2-NEAT1 promote rather than prevent cell death will be crucial in the development of effective therapeutic strategies. This study underscores the pivotal role of the EZH2-NEAT1 axis in copper-induced tumor cell death, advancing the functional understanding of non-coding RNAs and epigenetic regulation in metal-based therapeutics. To accelerate clinical translation, future research should prioritize: in-depth mechanistic analysis of NEAT1-mediated death signaling, extracellular release routes, and functional-state transitions; in vivo validation and preclinical evaluation of its pro-death effects alongside synergistic potential with copper-based drugs; assessment of EZH2/NEAT1 expression as predictive non-invasive biomarkers for therapy response; systematic profiling of its immunomodulatory impact on tumor-microenvironment immune subsets; and deeper insights into how epigenetic regulators such as EZH2-NEAT1 dynamically govern cell-fate decisions, thereby informing the rational design of next-generation epigenetic-metallodrug combination strategies.
Conclusions
This study demonstrates that the EZH2-NEAT1 epigenetic axis serves as a critical regulator of cuproptosis sensitivity in CRC. We demonstrate that EZH2 transcriptionally activates NEAT1 by maintaining H3K27 acetylation at its promoter, extending the mechanism previously identified in immune cells to cancer metabolism. NEAT1, in turn, functions as a pro-death mediator that enhances proteotoxic stress responses and promotes the aggregation of lipoylated DLAT, thereby sensitizing cells to copper‑induced cell death.
In summary, our work establishes a novel epigenetic mechanism governing cuproptosis and reveals the multifaceted role of the EZH2‑NEAT1 axis in CRC cell death and microenvironment modulation. Future studies should validate these findings in vivo, elucidate the precise mechanisms of NEAT1-mediated death promotion and secretion, and comprehensively evaluate the clinical utility of this axis as a biomarker for copper‑based cancer therapy.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1058/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1058/dss
Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1058/prf
Funding: This work was supported by
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1058/coif). Y.L. reports funding support from the China International Medical Foundation (No. Z-2017-24 2110). C.L. reports funding support from the Jiangxi Provincial Natural Science Foundation (No. 20242BAB25537). The other authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Zhang T, Guo Y, Qiu B, et al. Global, regional, and national trends in colorectal cancer burden from 1990 to 2021 and projections to 2040. Front Oncol 2024;14:1466159. [Crossref] [PubMed]
- El-Sheikh NM, Abulsoud AI, Fawzy A, et al. LncRNA NNT-AS1/hsa-miR-485-5p/HSP90 axis in-silico and clinical prospect correlated-to histologic grades-based CRC stratification: A step toward ncRNA Precision. Pathol Res Pract 2023;247:154570. [Crossref] [PubMed]
- Siegel RL, Wagle NS, Cercek A, et al. Colorectal cancer statistics, 2023. CA Cancer J Clin 2023;73:233-54. [Crossref] [PubMed]
- Morgan E, Arnold M, Gini A, et al. Global burden of colorectal cancer in 2020 and 2040: incidence and mortality estimates from GLOBOCAN. Gut 2023;72:338-44. [Crossref] [PubMed]
- Liu WQ, Lin WR, Yan L, et al. Copper homeostasis and cuproptosis in cancer immunity and therapy. Immunol Rev 2024;321:211-27. [Crossref] [PubMed]
- Wang Y, Chen Y, Zhang J, et al. Cuproptosis: A novel therapeutic target for overcoming cancer drug resistance. Drug Resist Updat 2024;72:101018. [Crossref] [PubMed]
- Atta H, Alzahaby N, Hamdy NM, et al. New trends in synthetic drugs and natural products targeting 20S proteasomes in cancers. Bioorg Chem 2023;133:106427. [Crossref] [PubMed]
- Tsvetkov P, Coy S, Petrova B, et al. Copper induces cell death by targeting lipoylated TCA cycle proteins. Science 2022;375:1254-61. [Crossref] [PubMed]
- Tsvetkov P, Detappe A, Cai K, et al. Mitochondrial metabolism promotes adaptation to proteotoxic stress. Nat Chem Biol 2019;15:681-9. [Crossref] [PubMed]
- Huang XY, Shen JY, Huang K, et al. Cuproptosis in cancers: Function and implications from bench to bedside. Biomed Pharmacother 2024;176:116874. [Crossref] [PubMed]
- Wu X, Bai Z, Wang H, et al. CRISPR-Cas9 gene editing strengthens cuproptosis/chemodynamic/ferroptosis synergistic cancer therapy. Acta Pharm Sin B 2024;14:4059-72. [Crossref] [PubMed]
- Cao R, Wang L, Wang H, et al. Role of histone H3 lysine 27 methylation in Polycomb-group silencing. Science 2002;298:1039-43. [Crossref] [PubMed]
- Margueron R, Reinberg D. The Polycomb complex PRC2 and its mark in life. Nature 2011;469:343-9. [Crossref] [PubMed]
- Sokolov D, Sharda N, Banerjee A, et al. Differential Signaling Pathways in Medulloblastoma: Nano-biomedicine Targeting Non-coding Epigenetics to Improve Current and Future Therapeutics. Curr Pharm Des 2024;30:31-47. [Crossref] [PubMed]
- Xu M, Xu C, Wang R, et al. Treating human cancer by targeting EZH2. Genes Dis 2025;12:101313. [Crossref] [PubMed]
- Huang J, Yin Q, Wang Y, et al. EZH2 Inhibition Enhances PD-L1 Protein Stability Through USP22-Mediated Deubiquitination in Colorectal Cancer. Adv Sci (Weinh) 2024;11:e2308045. [Crossref] [PubMed]
- Xu K, Wu ZJ, Groner AC, et al. EZH2 oncogenic activity in castration-resistant prostate cancer cells is Polycomb-independent. Science 2012;338:1465-9. [Crossref] [PubMed]
- Yuan J, Zhu Q, Zhang X, et al. Ezh2 competes with p53 to license lncRNA Neat1 transcription for inflammasome activation. Cell Death Differ 2022;29:2009-23. [Crossref] [PubMed]
- Li L, Zhou H, Zhang C. Cuproptosis in cancer: biological implications and therapeutic opportunities. Cell Mol Biol Lett 2024;29:91. [Crossref] [PubMed]
- Jiang C, Xin H, Liu Y, et al. Cuproptosis as a therapeutic target in cancer: a Systematic Review and bibliometric analysis of the research landscape. Front Oncol 2025;15:1566986. [Crossref] [PubMed]
- Feng Q, Sun Y, Yang Z, et al. Copper in the colorectal cancer microenvironment: pioneering a new era of cuproptosis-based therapy. Front Oncol 2024;14:1522919. [Crossref] [PubMed]
- Zhang C, Huang T, Li L. Targeting cuproptosis for cancer therapy: mechanistic insights and clinical perspectives. J Hematol Oncol 2024;17:68. [Crossref] [PubMed]
- Springer C, Humayun D, Skouta R. Cuproptosis: Unraveling the Mechanisms of Copper-Induced Cell Death and Its Implication in Cancer Therapy. Cancers (Basel) 2024;16:647. [Crossref] [PubMed]
- Zhou S, Liu J, Wan A, et al. Epigenetic regulation of diverse cell death modalities in cancer: a focus on pyroptosis, ferroptosis, cuproptosis, and disulfidptosis. J Hematol Oncol 2024;17:22. [Crossref] [PubMed]
- Lai Y, Han X, Xie B, et al. EZH2 suppresses ferroptosis in hepatocellular carcinoma and reduces sorafenib sensitivity through epigenetic regulation of TFR2. Cancer Sci 2024;115:2220-34. [Crossref] [PubMed]
- Long F, Li X, Pan J, et al. The role of lncRNA NEAT1 in human cancer chemoresistance. Cancer Cell Int 2024;24:236. [Crossref] [PubMed]
- Ibraheem Shelash Al-Hawari S, Abdalkareem Jasim S. An overview of lncRNA NEAT1 contribution in the pathogenesis of female cancers; from diagnosis to therapy resistance. Gene 2025;933:148975. [Crossref] [PubMed]
- Dong P, Xiong Y, Yue J, et al. Long Non-coding RNA NEAT1: A Novel Target for Diagnosis and Therapy in Human Tumors. Front Genet 2018;9:471. [Crossref] [PubMed]
- Wang W, Ge L, Xu XJ, et al. LncRNA NEAT1 promotes endometrial cancer cell proliferation, migration and invasion by regulating the miR-144-3p/EZH2 axis. Radiol Oncol 2019;53:434-42. [Crossref] [PubMed]
- Chen Q, Cai J, Wang Q, et al. Long Noncoding RNA NEAT1, Regulated by the EGFR Pathway, Contributes to Glioblastoma Progression Through the WNT/β-Catenin Pathway by Scaffolding EZH2. Clin Cancer Res 2018;24:684-95. [Crossref] [PubMed]
- Liu X, Zhang W, Wei S, et al. Targeting cuproptosis with nano material: new way to enhancing the efficacy of immunotherapy in colorectal cancer. Front Pharmacol 2024;15:1451067. [Crossref] [PubMed]
- Li J, Zhang G, Sun Z, et al. Immunogenic cuproptosis in cancer immunotherapy via an in situ cuproptosis-inducing system. Biomaterials 2025;319:123201. [Crossref] [PubMed]
- Wang QM, Lian GY, Sheng SM, et al. Exosomal lncRNA NEAT1 Inhibits NK-Cell Activity to Promote Multiple Myeloma Cell Immune Escape via an EZH2/PBX1 Axis. Mol Cancer Res 2024;22:125-36. [Crossref] [PubMed]
- Li A, Hong J, Ma X, et al. Cancer-Derived Exosomal LINC01615 Induces M2 Polarization of Tumor-Associated Macrophages via RBMX-EZH2 Axis to Promote Colorectal Cancer Progression. Int J Nanomedicine 2025;20:7343-58. [Crossref] [PubMed]
- Sun L, Zhang Y, Yang B, et al. Lactylation of METTL16 promotes cuproptosis via m(6)A-modification on FDX1 mRNA in gastric cancer. Nat Commun 2023;14:6523. [Crossref] [PubMed]
- Mao C, Wang M, Zhuang L, et al. Metabolic cell death in cancer: ferroptosis, cuproptosis, disulfidptosis, and beyond. Protein Cell 2024;15:642-60. [Crossref] [PubMed]
- Tong X, Tang R, Xiao M, et al. Targeting cell death pathways for cancer therapy: recent developments in necroptosis, pyroptosis, ferroptosis, and cuproptosis research. J Hematol Oncol 2022;15:174. [Crossref] [PubMed]

