TRNP1 regulates tumorigenesis and enhances immunotherapy response via c-Kit/STAT3 signaling in hepatocellular carcinoma
Highlight box
Key findings
• TMF1-regulated nuclear protein 1 (TRNP1), upregulated in hepatocellular carcinoma (HCC), drives proliferation, migration, invasion, and apoptosis resistance via c-Kit/signal transducers and activators of transcription 3 (STAT3), while its knockdown enhances anti-PD-1 efficacy and M1 macrophage polarization.
What is known and what is new?
• TRNP1 was known to be elevated in HCC, but its mechanism was unclear.
• TRNP1 promotes HCC malignancy through c-Kit/STAT3 signaling and, for the first time, shows that TRNP1 knockdown sensitizes tumors to immunotherapy and remodels the immune microenvironment.
What is the implication, and what should change now?
• TRNP1 is a potential prognostic biomarker and therapeutic target. Combining TRNP1 targeting with PD-1 blockade may improve HCC treatment. Specific inhibitors and clinical validation are needed.
Introduction
Hepatocellular carcinoma (HCC) is the most common primary liver malignancy, representing a significant global health burden due to its typically asymptomatic onset, poor prognosis, and high mortality rate (1-3). In addition to established risk factors such as viral hepatitis and chronic alcohol consumption, non-alcoholic fatty liver disease (NAFLD) is emerging as a major contributor to the global increase in HCC incidence (4). Current clinical treatments for HCC include surgical options such as liver transplantation and resection, locoregional therapies like radiofrequency ablation and transarterial approaches, as well as systemic therapies including chemotherapy, immunotherapy, targeted therapy and combination strategies (5-7). However, despite these therapeutic advances, the high recurrence rate, frequent metastasis, and prevalent chemoresistance result in an overall low survival rate for HCC patients (8,9). Therefore, there is an urgent need to explore novel molecular mechanisms involved in HCC development and progression to identify new therapeutic targets.
TMF1-regulated nuclear protein 1 (TRNP1) is a highly conserved nuclear protein encoded by a single exon on chromosome 1p36.11 in humans and chromosome 4 D3 in mice. The TRNP1 protein comprises 227 amino acids in humans and chimpanzees, while it consists of 223 amino acids in mice. Ectopic expression of TRNP1 in breast cancer cells, which do not typically express this protein, has promoted cell proliferation by accelerating the transition from the G0/G1 phase to the S phase of the cell cycle. Furthermore, TRNP1 is targeted for degradation via the proteasome, mediated by the TATA element regulator (TMF/ARA160) (10,11). Beyond its oncogenic role, TRNP1 is an important regulator of neural stem cell (NSC) dynamics, with high expression levels promoting NSC self-renewal and tangential expansion, while lower levels associated with radial expansion (12,13).
Importantly, recent studies have demonstrated that TRNP1 is upregulated in HCC, where its knockdown induces apoptosis in HCC cells and inhibits tumor growth. These findings suggest a potential role for TRNP1 in cellular senescence and tumor progression (14). Additionally, TRNP1 has been proposed as a diagnostic biomarker linked to mitochondrial autophagy, further underscoring its relevance to HCC prognosis (15). Given these observations, a deeper understanding of the molecular mechanisms regulated by TRNP1 is necessary to elucidate its role in HCC pathogenesis and to explore its potential as a therapeutic target.
In this study, we investigated the role of TRNP1 in HCC development and progression through in vivo and in vitro experiments, focusing on its involvement in tumorigenesis and immune evasion via the c-Kit/signal transducers and activators of transcription 3 (STAT3) signaling pathway. These findings provide insights into the molecular underpinnings of HCC and highlight TRNP1 as a promising target for future therapeutic interventions. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1084/rc).
Methods
Cell culture and transfection
In this study, the human HCC cell lines Sk-hep1, Hep3B, and HepG2 were obtained from the American Type Culture Collection (ATCC). Huh7, LM3 and the mouse HCC cell line Hepa 1–6 were obtained from the Cell Bank of Type Culture Collection of the Chinese Academy of Sciences. YY8103 was a gift from Dong Xie lab of Shanghai Institute of Nutrition and Health. All cells were cultured in their respective appropriate media and culture conditions. The lentiviral vector containing human TRNP1 was purchased from Hanbio (Shanghai, China). The siRNA sequence for TRNP1 is shown in Table 1. Subsequently, Sk-hep1, YY8103 and Huh7 cell densities reached about 50%, and 1 µg/mL of puromycin was administered for 48 h, repeated 3 times. In addition, the transfection efficiency was verified by quantitative real-time polymerase chain reaction (q-PCR) and western blotting.
Table 1
| Names | Forward (5'-3') | Reverse (5'-3') |
|---|---|---|
| TRNP1-sh1 (human) | GGUUCCUGGAGCAGCUUGUAUTT | AUACAAGCUGCUCCAGGAACCTT |
| TRNP1-sh2 (human) | GACCUCUGGAUUCGGCUUUCUTT | AGAAAGCCGAAUCCAGAGGUCTT |
| shTRNP1 (mouse) | AGCUGCACCGAGUCUUCUUTT | AAGAAGACUCGGUGCAGCUTT |
siRNA, small interfering RNA; TRNP1, TMF1-regulated nuclear protein 1.
Cell proliferation assay
To perform cell proliferation tests, 2×103 cells were seeded into 96-well plates and then incubated for 4, 24, 48, 72, 96 h respectively before adding 10 µL of Cell Counting Kit-8 (CCK-8, Hanbio, China). After 1 h of incubation, the optical density was measured at 450 nm.
Colony formation assay
HCC cells were seeded in 6-well plates with 3×103 cells/well and incubated at 37 ℃ in 5% CO2 for 8 days. Then washed once with PBS, fixed with 4% paraformaldehyde for 20 minutes, stained with 0.5% (w/v) crystal violet for 20 minutes, and counted the number of colonies.
Transwell cell migration and invasion assays
Using 24-well Transwell plates (8 µm; Corning, NY, USA) evaluated the migration and invasion capacity of HCC cells. For the migration test, 5×104 cells suspended in serum-free medium were added to the upper chamber, and 600 µL of DMEM containing 20% FBS was added to the lower chamber. After incubation for 12 h, the cells were fixed with 4% paraformaldehyde for 20 min and stained with 0.5% (w/v) crystal violet for 20 min. At 10× magnification, the migration and invasion indices were calculated using the average number of cells in three random fields. To perform the invasion test, the Transwell chamber was coated with 50 µL diluted Matrigel (1:8, BD Biosciences) and hydrated for 2 hours. In addition to the cell incubation for 24 hours, the other steps were the same as the migration experiment.
q-PCR
According to the manufacturer’s protocol, total RNA was extracted using TRIzol reagent (Invitrogen, USA). q-PCR was performed using PrimeScript RT kit (TaKaRa, Tokyo, Japan) and SYBR Premix Ex Taq (TaKaRa, Tokyo, Japan). Target genes were quantified by 2−ΔΔCt and normalized by glyceraldehyde 3-phosphate dehydrogenase (GAPDH). Then, the primer sequences used are shown in Table 2.
Table 2
| Names | Forward (5'-3') | Reverse (3'-5') |
|---|---|---|
| GAPDH | AGAAGGCTGGGGCTCATTTG | AGGGGCCATCCACAGTCTTC |
| TRNP1 | AGCTGCACCGCGTTTTCTTGGC | TTCTTGAGGCGCGACCCGTGA |
| KIT | CACCGAAGGAGGCACTTACACA | TGCCATTCACGAGCCTGTCGTA |
| CD90 | GAAGGTCCTCTACTTATCCGCC | TGATGCCCTCACACTTGACCAG |
| NANOG | CTCCAACATCCTGAACCTCAGC | CGTCACACCATTGCTATTCTTCG |
| CD44 | CCAGAAGGAACAGTGGTTTGGC | ACTGTCCTCTGGGCTTGGTGTT |
| OCT4 | CCTGAAGCAGAAGAGGATCACC | AAAGCGGCAGATGGTCGTTTGG |
| SOX2 | GCTACAGCATGATGCAGGACCA | TCTGCGAGCTGGTCATGGAGTT |
| ANXA1 | GAGCCCCTATCCTACCTTCAATC | GCTTCATCCACACCTTTAACCAT |
ANXA1, annexin a1; CD44, cluster of differentiation 44; CD90, cluster of differentiation 90; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; KIT, KIT proto-oncogene; NANOG, Nanog homeobox; OCT4, octamer-binding transcription factor 4; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; SOX2, SRY-Box transcription factor 2; TRNP1, TMF1-regulated nuclear protein 1.
Western blotting
Proteins were extracted from RIPA buffer (Sigma-Aldrich, St. Louis, USA) containing phosphatase inhibitors and protease inhibitors. The protein lysates were separated by sodium dodecyl sulfate polyacrylamide gels (SDS-PAGE) and then transferred to PVDF membrane. The membranes were blocked for 1 h and incubated overnight at 4 ℃ with the primary antibodies: TRNP1 (Abcam, 174303), c-Kit (CST, 3074S), STAT3 (CST, 9139S), phosphorylated STAT3 (Tyr705) (P-STAT3) (CST, 9145S), E-cadherin (CST, 14472S), N-cadherin (CST, 13116S), proliferating cell nuclear antigen (PCNA) (CST, 2586S), Caspase3 (Abmart, T40044S), Cleaved-caspase3 (Abmart, TA7022S), Bax (Abmart, T40051S), Bcl-2 (Abmart, T40056S) and β-Actin (Proteintech, 66009-1-Ig). The horseradish peroxidase (HRP)-conjugated secondary antibody was used at 1:2,000. Finally, the bands were visualized with ECL reagent (Shanghai, China).
Immunohistochemistry (IHC)
HCC tissue samples were collected from the First Affiliated Hospital of Xi’an Jiaotong University between October 2024 and October 2025. The HCC tissues and adjacent normal tissues were fixed with 4% paraformaldehyde and embedded in paraffin. After the sections were dewaxed and rehydrated, the peroxidase activity was blocked with hydrogen peroxide. The sections were incubated with primary antibody (TRNP1, PCNA, E-Cadherin, N-Cadherin, c-Kit, P-STAT3) at 4 ℃ overnight, and then treated with biotinylated secondary antibody for 30 min. In addition, the sections were treated with 3,3'-diaminobenzidine (DAB) substrate. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Xi’an Jiaotong University (No. XJTU1AF2024LSYY-382). All patients provided written informed consent.
Flow cytometric analysis for apoptosis
The cells were digested with trypsin solution (without EDTA) and centrifuged at 1,400 rpm, 5 min per session and washed 3 times with pre-cooled PBS buffer. After resuspension with 500 µL 1× binding buffer, apoptosis was analyzed with propidium iodide (PI)-Annexin V (APC) assay kit (MultiSciences, AT107, China). Treatment with 10 µL Annexin V-APC and 5 µL PI for 15 min (room temperature, away from light). The samples were loaded into flow cytometer (Beckman Coulter, Inc., Brea, CA, USA) for testing.
Animal experiments
The 6-week-old male BALB/c nude mice were purchased from Xi’an Jiaotong University (Xi’an, China). They were divided into 3 groups (n=6 per group) for the experiment. Sk-hep1 cells transfected with TRNP1 lentivirus or vector were used. 3×106 cells were injected into the flank of mice. The tumor volumes were measured every 3 days, and the mice were euthanized on day 15, and tumors were excised and weighed.
The 8-week-old male C57BL/6 mice were purchased from Xi’an Jiaotong University (Xi’an, China). They were divided into 4 groups (n=6 each). Hepa 1-6 cells (n=5×106) containing TRNP1-NC and TRNP1-sh2 lentivirus were inoculated into the armpit. Among them, NC + anti-programmed cell death protein 1 (PD-1) and sh2 + anti-PD-1 groups were intraperitoneally injected with 0.2 mg of anti-mouse PD-1 (InVivoMAbTM) every 3 days, and the rest were injected with an equal volume of PBS for 3 times. The tumor volume was measured every 3 days, euthanized after 12 days, then resected and the tumor volume was calculated.
The mice were sacrificed via cervical dislocation after isofluorane (2%) anesthesia. All animal experiments were performed under a project license (No. XJTUAE2023-460) granted by Ethics Committee of First Affiliated Hospital of Xi’an Jiaotong University, in compliance with national guidelines for the care and use of animals.
Flow cytometry for macrophage analysis
The tumors underwent digestion with DNase I and collagenase were mechanically dissociated into single-cell suspensions, then they were resuspended in washing buffer. For extracellular staining, fluorochrome-labeled monoclonal antibodies or their isotype controls were applied at concentrations recommended by the manufacturer. After being incubated at room temperature in the dark for 15 minutes, the samples were washed and analyzed on a FACSCanto II flow cytometer. The data was processed using FACSDiva 6.1.3 software. The antibodies were APC-CY7 anti-mouse CD45 (BD Pharmingen, 557659), BV421 anti-mouse F4/80 (BD Pharmingen, 565411), APC anti-mouse CD206 (BD Pharmingen, 565250), BV786 anti-mouse CD86 (BD Pharmingen, 740900), FITC anti-mouse CD11b (BD Pharmingen, 557396).
Enzyme-linked immunosorbent assay (ELISA)
The frozen HCC tissue was thawed on ice, and a 20 mg portion was weighed and added to pre-chilled PBS. The tissue was sonicated until completely lysed, followed by centrifugation to collect the supernatant. The annexin A1 (ANXA1) content in the tumor tissue was then determined using an ELISA kit (ab264613, Abcam) according to the manufacturer’s instructions.
Statistical analysis
Each experiment was conducted using three biological replicates, each including three technical replicates. GraphPad Prism software version 8.0 (GraphPad, USA) was used for statistical analysis and visualization. All experimental data were expressed as mean ± standard deviation (SD). P value <0.05 was considered statistically significant. We performed an independent T-test for continuous variable comparisons between the two groups and a one-way ANOVA analysis of variance for comparisons between multiple groups. *, P<0.05; **, P<0.01; ***, P<0.001; and ****, P<0.0001.
Results
TRNP1 is upregulated in HCC tissues
Using The Cancer Genome Atlas (TCGA) dataset, we analyzed TRNP1 expression in HCC tissues and observed a significant upregulation compared to adjacent normal tissues (Figure 1A,1B). Survival analysis revealed that patients with high TRNP1 expression exhibited significantly poorer overall survival (OS) and disease-free survival (DFS) compared to those with lower expression (OS: P<0.01, DFS: P<0.01) (Figure 1C,1D). To further explore the clinical relevance of TRNP1, we collected 19 pairs of HCC tissues and adjacent normal tissues to assess TRNP1 messenger RNA (mRNA) expression. The results demonstrated a significantly higher TRNP1 mRNA level in HCC tissues than in paracancerous tissues (Figure 1E). Additionally, protein expression analysis using western blotting and IHC confirmed the elevated TRNP1 levels in HCC tissues (Figure 1F,1G).
TRNP1 promotes HCC proliferation, migration, invasion, and inhibits apoptosis
To determine the specific role of TRNP1 in HCC cells, we assessed its expression across various HCC cell lines, including HepG2, Hep3B, Huh7, Sk-hep1, YY8103, and HCC-LM3 (Figure 2A). TRNP1 was expressed at higher levels in Sk-hep1 and YY8103 cells compared to HepG2, Hep3B, Huh7, and HCC-LM3. Accordingly, Sk-hep1 and YY8103 cell lines were selected for further functional studies. Stable TRNP1 knockdown was achieved, as confirmed by western blot analysis (Figure 2B). Knockdown of TRNP1 led to significantly reduced cell viability, as shown by the CCK-8 assay and colony formation assay (Figure 2C,2D). Furthermore, migration and invasion assays revealed that TRNP1 knockdown notably impaired these capacities in Sk-hep1 and YY8103 cells (Figure 2E,2F). Apoptosis was significantly increased in TRNP1 knockdown cells compared to controls (Figure 2G).
We assessed the expression of apoptosis-related proteins to investigate the underlying mechanism of increased apoptosis. TRNP1 knockdown cells displayed increased levels of pro-apoptotic Bax and cleaved-caspase3 and reduced levels of the anti-apoptotic protein Bcl-2 and stem cell genes (Figure 2H,2I). To further assess TRNP1’s role, a stable TRNP1 overexpression model was established in the Huh7 cell line, confirmed by western blotting (Figure 3A). Overexpression of TRNP1 promoted cell viability, colony formation, migration, and invasion in a series of assays (Figure 3B-3E).
TRNP1 promotes tumor growth in vivo
To validate the role of TRNP1 in vivo, we established a subcutaneous xenograft model using Sk-hep1 cells transfected with either TRNP1 knockdown or control vectors. Tumor growth was significantly reduced in the TRNP1 knockdown group compared to the control group, as evidenced by smaller tumor volumes and reduced growth rates (Figure 4A-4C). Furthermore, TRNP1 knockdown tumors exhibited reduced expression of PCNA, a marker of cell proliferation and a potential diagnostic biomarker for HCC (16,17), as confirmed by western blotting and IHC staining (Figure 4D,4E). These findings further support the role of TRNP1 in promoting tumorigenesis in HCC.
TRNP1 modulates malignant phenotype via the c-Kit/STAT3 signaling pathway
To elucidate the regulatory pathways influenced by TRNP1 in HCC, transcriptomic sequencing was performed. Differential gene expression analysis, visualized through a volcano plot, revealed significant alterations in gene expression in Sk-hep1 cells following TRNP1 knockdown compared to the negative control (NC) group (Figure 5A). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis highlighted the Janus kinase/signal transducers and activators of transcription (JAK/STAT) signaling pathway as one of the top 20 enriched pathways (Figure 5B). Specifically, the c-Kit (also named as KIT) mRNA expression was significantly reduced in TRNP1 knockdown cells (fold change =0.41), further confirmed through q-PCR (Figure 5C). Furthermore, western blot analysis revealed a notable decrease in both c-Kit and P-STAT3 levels in TRNP1 knockdown cells and subcutaneous tumors derived from these cells (Figure 5D-5F). These findings indicate that TRNP1 exerts its oncogenic effects in HCC by activating the c-Kit/STAT3 signaling pathway.
Epithelial-mesenchymal transition (EMT) is a crucial mechanism in cancer cell migration and invasion, driving tumor progression and metastasis (18-20). To assess the influence of TRNP1 on EMT, we analyzed the expression of key EMT markers. Western blotting revealed that TRNP1 knockdown led to increased levels of the epithelial marker E-cadherin and decreased levels of the mesenchymal marker N-cadherin in Sk-hep1 and YY8103 cells (Figure 5E). These results were corroborated by IHC analysis (Figure 5G). Together, these findings suggest that TRNP1 facilitates EMT in HCC, promoting an aggressive malignant phenotype.
TRNP1 knockdown enhances therapeutic response to PD-1 blockade
PD-1, encoded by the PDCD1 gene, plays a critical role in immune suppression and has become a key target in immunotherapy for HCC (21-23). Using the Gene Expression Profiling Interactive Analysis (GEPIA) bioinformatics tool, we analyzed the correlation between TRNP1 and PDCD1 expression in HCC and found a significant positive correlation (Figure 6A). To further investigate this interaction, we established a mouse model in which C57BL/6 mice bearing Hepa 1-6 cells (transfected with either TRNP1 knockdown or NC vectors) were treated with anti-mouse PD-1 antibody (anti-PD-1) (Figure 6B,6C). Results showed that either TRNP1 knockdown or anti-PD-1 treatment significantly reduced tumor growth compared to the control group. Importantly, the combination of TRNP1 knockdown and anti-PD-1 therapy further reduced tumor weight and volume (Figure 6D,6E).
According to TCGA database, TRNP1 expression was positively correlated with the presence of natural killer (NK) CD56bright cells, macrophages, Th2 cells, T follicular helper (TFH) cells, and T effector memory (Tem) cells, among others. Conversely, TRNP1 was negatively correlated with Th17 cells, neutrophils, gamma delta (Tgd) T cells, central memory T (TCM) cells, eosinophils, and CD8+ T cells (Figure 6F). Because macrophages play an important role in the tumor immune microenvironment, we analyzed the proportion of M1 and M2 macrophages in Hepa 1–6 subcutaneous tumors. When TRNP1 was knocked down, the proportion of M1 macrophages in tumor tissues increased significantly, while the proportion of M2 macrophages decreased, leading to a reduction in cancer-promoting M2 macrophages (Figure 6G). At the same time, based on transcriptome results, we identified the cytokine ANXA1 (Figure 6H). Studies have shown that ANXA1 promotes malignant growth and metastasis in mice by increasing the infiltration of tumor-associated macrophages (TAMs) and M2 polarization in HCC (24). The results of q-PCR and ELISA demonstrated that compared with the NC group, the level of ANXA1 in the TRNP1 knockdown group was significantly lower (Figure 6I,6J), thereby reducing macrophage M2 polarization and increasing M1 polarization. These data suggest that TRNP1 can modulate immune cell infiltration in the tumor microenvironment, especially the macrophages, influencing the response to PD-1 blockade therapy.
Discussion
HCC ranks as the fourth leading cause of cancer-related mortality worldwide despite advancements in diagnostic methods and treatment strategies over recent years (25,26). Unfortunately, effective therapeutic options for patients with intermediate and advanced HCC remain limited. In this study, we demonstrated that TRNP1 expression is significantly elevated in HCC and is associated with enhanced cell proliferation, migration, invasion, and inhibition of apoptosis. Our findings indicate that TRNP1 promotes HCC progression via activation of the c-Kit/STAT3 signaling pathway, establishing it as a tumor-promoting factor with the potential to serve as a clinical biomarker in HCC.
Beyond its known role in neural development and cell self-renewal, TRNP1 has garnered attention in cancer research due to its oncogenic potential. Initially identified in breast cancer, TRNP1 has been shown to enhance cell proliferation by facilitating progression through the G0/G1 to S phase transition, mediated by TMF1 and the E3 ubiquitin ligase (10). In HCC, TRNP1 has been implicated as a prognostic biomarker, with its expression correlating with immune cell infiltration and patient outcomes (27,28). Consistent with these reports, we observed that TRNP1 knockdown in highly metastatic HCC cell lines (Sk-hep1 and YY8103) led to reduced tumor growth, both in vitro and in vivo. In contrast, TRNP1 overexpression in Huh7 cells resulted in increased tumor growth. Importantly, EMT, a critical process in cancer metastasis, was shown to be influenced by TRNP1. Our results suggest that TRNP1 enhances the EMT process, facilitating the transformation of epithelial cells to a more mesenchymal, invasive phenotype, a key factor in HCC metastasis (29,30).
The c-Kit (CD117) receptor, a type III receptor tyrosine kinase family member, is a well-known regulator of cell proliferation and survival. Dysregulated c-Kit signaling has been implicated in various malignancies, including gastrointestinal stromal tumors, acute myeloid leukemia, and melanoma (31,32). The present study demonstrated that TRNP1 knockdown significantly reduced c-Kit expression, as confirmed by transcriptomic analysis, q-PCR, and western blotting. This reduction in c-Kit led to downstream inhibition of the JAK/STAT pathway, specifically reducing P-STAT3 levels. Given the established role of the c-Kit/STAT3 axis in cancer progression, these findings highlight the critical contribution of TRNP1 in promoting HCC growth through this pathway.
Moreover, our study explored the interaction between TRNP1 and immune modulation, particularly in PD-1 blockade therapy. PD-1 is a well-established immunosuppressive molecule, primarily expressed in T cells, B cells, and NK cells (33,34). Immunotherapies targeting the PD-1/programmed death ligand 1 (PD-L1) checkpoint have shown promise in treating HCC, particularly in combination with other therapies such as anti-angiogenic tyrosine kinase inhibitors (35,36). Our findings indicate that TRNP1 knockdown enhances the therapeutic efficacy of PD-1 blockade. Specifically, TRNP1 knockdown, in combination with anti-PD-1 therapy, significantly reduced tumor volume compared to either treatment alone. Furthermore, we identified correlations between TRNP1 expression and immune cell infiltration in the tumor microenvironment, including positive correlations with cells such as NK CD56bright cells, macrophages and Th2 cells and negative correlations with CD8+ T cells and Th17 cells (37,38). Specifically, the knockdown of TRNP1 leads to reduced ANXA1 levels, thereby shifting the balance of tumor-associated macrophages toward an increased proportion of the M1 subtype and a decreased proportion of the M2 subtype. These findings suggest that TRNP1-mediated modulation of ANXA1 expression in tumor cells may influence the polarization status of adjacent immune cells within the tumor microenvironment. The knockdown of TRNP1 led to an increase in the proportion of M1 macrophages and a decrease in M2 macrophages in tumor tissues. While these findings suggest that TRNP1 may modulate immune infiltration in HCC, the precise mechanisms underlying these effects warrant further investigation.
Despite the promising findings, our study has several limitations that warrant consideration. The research was conducted primarily using established HCC cell lines and xenograft mouse models. While these models are valuable, they may not fully recapitulate the heterogeneity and complex immune interplay of human HCC. Therefore, validation of our findings in patient-derived organoids or xenografts and analysis of TRNP1 expression in large clinical cohorts of ICI-treated patients are necessary next steps. Furthermore, the precise molecular mechanism by which TRNP1, a nuclear protein, regulates the expression or activity of the cell surface receptor c-Kit remains to be fully elucidated. Future studies should investigate whether TRNP1 acts as a transcription factor or co-factor for the KIT gene, or if it influences c-Kit through an indirect mechanism. Finally, while we focused on the c-Kit/STAT3 axis, it is plausible that TRNP1 may regulate other oncogenic pathways that contribute to its effects, which represents another avenue for future investigation.
Conclusions
In conclusion, this study establishes TRNP1 as a key oncogenic factor in HCC, driving tumor progression by activating the c-Kit/STAT3 signaling pathway. Our findings demonstrate that TRNP1 knockdown effectively inhibits HCC cell proliferation, migration, and invasion while enhancing apoptosis, thereby attenuating tumor growth. Furthermore, combining TRNP1 knockdown with anti-PD-1 immunotherapy represents a promising therapeutic strategy, as it significantly enhances the efficacy of immune checkpoint inhibition. These insights suggest that targeting TRNP1 may offer a novel approach to improving treatment outcomes for patients with HCC, particularly when integrated with immunotherapeutic interventions.
Acknowledgments
We thank all the authors for their contributions to this study.
Footnote
Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1084/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1084/dss
Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1084/prf
Funding: This work was partially supported by grants from
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1084/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work, ensuring that any questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Medical Ethics Committee of the First Affiliated Hospital of Xi’an Jiaotong University (No. XJTU1AF2024LSYY-382). All patients provided written informed consent. All animal experiments were performed under a project license (No. XJTUAE2023-460) granted by Ethics Committee of First Affiliated Hospital of Xi’an Jiaotong University, in compliance with national guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Nagaraju GP, Dariya B, Kasa P, et al. Epigenetics in hepatocellular carcinoma. Semin Cancer Biol 2022;86:622-32. [Crossref] [PubMed]
- Ganesan P, Kulik LM. Hepatocellular Carcinoma: New Developments. Clin Liver Dis 2023;27:85-102. [Crossref] [PubMed]
- Bas O, Sahin TK, Karahan L, et al. Prognostic significance of the cachexia index (CXI) in patients with cancer: A systematic review and meta-analysis. Clin Nutr ESPEN 2025;68:240-7. [Crossref] [PubMed]
- Caturano A, Erul E, Nilo R, et al. Metabolic dysfunctionassociated steatotic liver disease, insulin resistance and hepatocellular carcinoma: A deadly triad. Eur J Clin Invest 2026;56:e70132. [Crossref] [PubMed]
- Rizzo A. Locoregional treatments plus immunotherapy in hepatocellular carcinoma: where do we stand? Future Oncol 2022;18:1665-8. [Crossref] [PubMed]
- Rizzo A, Ricci AD. Challenges and Future Trends of Hepatocellular Carcinoma Immunotherapy. Int J Mol Sci 2022;23:11363. [Crossref] [PubMed]
- Rizzo A, Ricci AD, Brandi G. Trans-Arterial Chemoembolization Plus Systemic Treatments for Hepatocellular Carcinoma: An Update. J Pers Med 2022;12:1788. [Crossref] [PubMed]
- Chidambaranathan-Reghupaty S, Fisher PB, Sarkar D. Hepatocellular carcinoma (HCC): Epidemiology, etiology and molecular classification. Adv Cancer Res 2021;149:1-61. [PubMed]
- Oura K, Morishita A, Tani J, et al. Tumor Immune Microenvironment and Immunosuppressive Therapy in Hepatocellular Carcinoma: A Review. Int J Mol Sci 2021;22:5801. [Crossref] [PubMed]
- Volpe M, Shpungin S, Barbi C, et al. trnp: A conserved mammalian gene encoding a nuclear protein that accelerates cell-cycle progression. DNA Cell Biol 2006;25:331-9. [Crossref] [PubMed]
- Perry E, Tsruya R, Levitsky P, et al. TMF/ARA160 is a BC-box-containing protein that mediates the degradation of Stat3. Oncogene 2004;23:8908-19. [Crossref] [PubMed]
- Esgleas M, Falk S, Forné I, et al. Trnp1 organizes diverse nuclear membrane-less compartments in neural stem cells. EMBO J 2020;39:e103373. [Crossref] [PubMed]
- Stahl R, Walcher T, De Juan Romero C, et al. Trnp1 regulates expansion and folding of the mammalian cerebral cortex by control of radial glial fate. Cell 2013;153:535-49. [Crossref] [PubMed]
- Wang HH, Chen WL, Cui YY, et al. Cellular senescence throws new insights into patient classification and pharmacological interventions for clinical management of hepatocellular carcinoma. World J Gastrointest Oncol 2023;15:1567-94. [Crossref] [PubMed]
- Tu DY, Cao J, Zhou J, et al. Identification of the mitophagy-related diagnostic biomarkers in hepatocellular carcinoma based on machine learning algorithm and construction of prognostic model. Front Oncol 2023;13:1132559. [Crossref] [PubMed]
- Ma S, Yang J, Li J, et al. The clinical utility of the proliferating cell nuclear antigen expression in patients with hepatocellular carcinoma. Tumour Biol 2016;37:7405-12. [Crossref] [PubMed]
- Li J, Yong T, Chen Y, et al. Targeting PCNA/PARP1 axis inhibits the malignant progression of hepatocellular carcinoma. Front Pharmacol 2025;16:1571786. [Crossref] [PubMed]
- Bakir B, Chiarella AM, Pitarresi JR, et al. EMT, MET, Plasticity, and Tumor Metastasis. Trends Cell Biol 2020;30:764-76. [Crossref] [PubMed]
- Dongre A, Weinberg RA. New insights into the mechanisms of epithelial-mesenchymal transition and implications for cancer. Nat Rev Mol Cell Biol 2019;20:69-84. [Crossref] [PubMed]
- Dong Y, Zheng Q, Wang Z, et al. Higher matrix stiffness as an independent initiator triggers epithelialmesenchymal transition and facilitates HCC metastasis. J Hematol Oncol 2019;12:112. [Crossref] [PubMed]
- Li B, Yan C, Zhu J, et al. Anti-PD-1/PD-L1 Blockade Immunotherapy Employed in Treating Hepatitis B Virus Infection-Related Advanced Hepatocellular Carcinoma: A Literature Review. Front Immunol 2020;11:1037. [Crossref] [PubMed]
- Wu H, Li Y, Shi G, et al. Hepatic interferon regulatory factor 8 expression suppresses hepatocellular carcinoma progression and enhances the response to antiprogrammed cell death protein-1 therapy. Hepatology 2022;76:1602-16. [Crossref] [PubMed]
- Zhu Y, Chen M, Xu D, et al. The combination of PD-1 blockade with interferon-α has a synergistic effect on hepatocellular carcinoma. Cell Mol Immunol 2022;19:726-37. [Crossref] [PubMed]
- Song Z, Wang X, Liu X, et al. Targeting of Annexin A1 in Tumor-associated Macrophages as a therapeutic strategy for hepatocellular carcinoma. Biochem Pharmacol 2023;213:115612. [Crossref] [PubMed]
- Faivre S, Rimassa L, Finn RS. Molecular therapies for HCC: Looking outside the box. J Hepatol 2020;72:342-52. [Crossref] [PubMed]
- Siegel RL, Miller KD, Jemal A. Cancer statistics, 2020. CA Cancer J Clin 2020;70:7-30. [Crossref] [PubMed]
- Ren Z, Gao D, Luo Y, et al. Identification of fatty acid metabolism-related clusters and immune infiltration features in hepatocellular carcinoma. Aging (Albany NY) 2023;15:1496-523. [Crossref] [PubMed]
- Liu J, Zhang SQ, Chen J, et al. Identifying Prognostic Significance of RCL1 and Four-Gene Signature as Novel Potential Biomarkers in HCC Patients. J Oncol 2021;2021:5574150. [Crossref] [PubMed]
- Dian MJ, Li J, Zhang XL, et al. MST4 negatively regulates the EMT, invasion and metastasis of HCC cells by inactivating PI3K/AKT/Snail1 axis. J Cancer 2021;12:4463-77. [Crossref] [PubMed]
- Giannelli G, Koudelkova P, Dituri F, et al. Role of epithelial to mesenchymal transition in hepatocellular carcinoma. J Hepatol 2016;65:798-808. [Crossref] [PubMed]
- Stankov K, Popovic S, Mikov M. C-KIT signaling in cancer treatment. Curr Pharm Des 2014;20:2849-80. [Crossref] [PubMed]
- Kalathil SG, Wang K, Hutson A, et al. Tivozanib mediated inhibition of c-Kit/SCF signaling on Tregs and MDSCs and reversal of tumor induced immune suppression correlates with survival of HCC patients. Oncoimmunology 2020;9:1824863. [Crossref] [PubMed]
- Vaddepally RK, Kharel P, Pandey R, et al. Review of Indications of FDA-Approved Immune Checkpoint Inhibitors per NCCN Guidelines with the Level of Evidence. Cancers (Basel) 2020;12:738. [Crossref] [PubMed]
- Goodman A, Patel SP, Kurzrock R. PD-1-PD-L1 immune-checkpoint blockade in B-cell lymphomas. Nat Rev Clin Oncol 2017;14:203-20. [Crossref] [PubMed]
- Jiang Y, Chen M, Nie H, et al. PD-1 and PD-L1 in cancer immunotherapy: clinical implications and future considerations. Hum Vaccin Immunother 2019;15:1111-22. [Crossref] [PubMed]
- Finn RS, Qin S, Ikeda M, et al. Atezolizumab plus Bevacizumab in Unresectable Hepatocellular Carcinoma. N Engl J Med 2020;382:1894-905. [Crossref] [PubMed]
- Lv T, Xiong X, Yan W, et al. Targeting of GSDMD sensitizes HCC to anti-PD-1 by activating cGAS pathway and downregulating PD-L1 expression. J Immunother Cancer 2022;10:e004763. [Crossref] [PubMed]
- Molgora M, Esaulova E, Vermi W, et al. TREM2 Modulation Remodels the Tumor Myeloid Landscape Enhancing Anti-PD-1 Immunotherapy. Cell 2020;182:886-900.e17. [Crossref] [PubMed]

