Luteolin suppresses the growth of colon cancer cells by inhibiting the IL-6/STAT3 signaling pathway
Introduction
With the advancements in medical technology and research, the prognosis of patients with stage I and II colon cancer has improved significantly, but the mortality rate remains high (1,2). Determining the pathological mechanism of colon cancer remains the focus of scientific research (3). Traditional Chinese medicine (TCM) is used to treat various diseases; it exhibits less toxicity and side effects and markedly improves the quality of life of patients (4-6). Examples of TCM include the anti-inflammatory effects of Qishen Yiqi dripping pills (7) and the antioxidant effects of tanshinone (8). Among the compounds utilized in TCM, luteolin is a natural flavonoid that is widely used as an anti-inflammatory (9), antioxidant (10), uric acid lowering (11), and anti-tumor (12) drug. In addition, a study by Ambasta et al. (13) reported that luteolin can treat colon cancer by modulating multiple signaling cascades. However, the mechanism underlying the effects of luteolin in colon cancer remains unclear.
The human leukemia mononuclear cell line (THP-1) has been widely employed to study the functions, signaling pathways, nutrition, and drug transport of monocytes/macrophages (14,15), and Phorbol 12-myristate 13-acetate (PMA) treatment is used to induce macrophage activation to establish an in vitro model for immunomodulatory research studies. Lipopolysaccharide (LPS) stimulation polarizes THP-1 macrophages into the M1 phenotype and releases cytokines such as tumor necrosis factor (TNF)-α and interleukin 6 (IL-6), which could be used as an inflammation model to explore the anti-inflammatory effects of various drugs (16-18).
IL-6/signal transducer and activator of transcription 3 (STAT3), an important signaling pathway, regulates the progression of several cancers, including colorectal cancer (19) and hepatocellular carcinoma (20), and is a promising target for cancer immunotherapy (21). In addition, studies have shown that the inflammatory tumor microenvironment can promote the activation of IL-6/STAT3, leading to cancer cell metastasis (22-24). Whether IL-6/STAT3 activation can be inhibited by luteolin and the underlying mechanism is still unknown.
In this study, we induced the growth of colon cancer cells by macrophage M1 polarization to explore the potential of luteolin in the treatment of colon cancer as well as its possible pharmacological and molecular mechanisms. The results of this study provide a theoretical basis for the treatment of colon cancer with luteolin. We present the following article in accordance with the MDAR reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-507/rc).
Methods
Cell culture, THP-1 polarization, and transwell assay
Human colon cancer cell lines (SW480 and SW620) were purchased from American Type Culture Collection (Virginia, USA) and cultured in Leibovitz’s L-15 medium (Gibco, Thermo Fisher Scientific, Inc., Massachusetts, USA). Human monocytic leukemia (THP-1) was purchased from Procell (Wuhan, China) and cultured in Roswell Park Memorial Institute-1640 medium (Gibco) supplemented with 10% fetal bovine serum (FBS; Gibco) at 37 ℃ and 5% carbon dioxide. To induce M1 polarization of the macrophages, 320 nmol/L PMA was added to the lower chamber of the transwell and incubated for 12 h (25), and then 1 µg/mL LPS was added to polarize the macrophages (26). SW480 and SW620 cells (1×105) were inoculated in the upper chamber of the transwell and incubated with IL-6 (50 ng/mL, ab9627, Abcam, Cambridge, UK) or anti-IL-6 antibody (20 ng/mL, ab233706, Abcam) for 24 h (27).
For the migration experiment, the cells were incubated for 24 h following the addition of 10% FBS to the lower chamber culture medium. Next, the cells were washed twice with phosphate buffer solution and fixed with absolute ethanol for 30 min, and finally stained with 0.1% crystal violet. SW480 and SW620 cells were counted using a light microscope (Olympus Corporation, Tokyo, Japan; magnification, ×200). In contrast to the migration assay, Matrigel® (BD Biosciences, New Jersey, USA) was used in the invasion experiment to coat the insert at 37 ℃ for 6 hours.
Reverse transcription quantitative polymerase chain reaction (RT-qPCR) assay
Total ribonucleic acid (RNA) was extracted from the SW480 and SW620 cells using TRIzol reagent (Gibco). After centrifugation at 13,000 × g (4 ℃, 10 min), 10 µL diethyl pyrocarbonate-treated water (Invitrogen, Thermo Fisher Scientific, Inc.) was added to the precipitate and RNA was reverse-transcribed into complementary DNA using the PrimeScript RT kit (Takara Bio, Japan). The SYBR® Premix Ex TaqTM II kit (Takara) was used to perform RT-qPCR analysis on the Applied Biosystems®7500 Real-Time PCR system (California, USA). PCR experiments were carried out according to the following steps: 95 ℃ for 10 min, 55 ℃ for 2 min, 72 ℃ for 2 min, followed by 40 cycles of 95 ℃ for 15 s and 60 ℃ for 32 s. The sequences of the primer pairs used are listed in Table 1. The IL-6 level was normalized to that of the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and calculated using the 2−ΔΔCt method (28).
Table 1
| Gene symbol | Forward primer 5'-3' | Reverse primer 5'-3' |
|---|---|---|
| IL-6 | GGCGTCCGAAGTATGAGTCC | TGCAACTTCCAAGCTTCGTC |
| GAPDH | GCTCATTTGCAGGGGGGAG | GTTGGTGGTGCAGGAGGCA |
GAPDH was used to normalize IL-6 expression. IL-6, interleukin 6; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Enzyme-linked immunosorbent assay (ELISA)
The SW480 and SW620 cell supernatants were collected to analyze the levels of IL-6. The IL-6 Quantikine ELISA kit (R6000B; R&D Systems, Minneapolis, MN, USA) was used according to the manufacturer’s instructions.
Western blotting
The SW480 and SW620 cells were lysed using Radio Immunoprecipitation Assay lysis buffer (Solarbio, Beijing, China). Protein concentrations were estimated using a bicinchoninic acid protein assay kit (Solarbio). Denatured proteins were resolved using 10% Sodium Dodecyl Sulfate-polyacrylamide gel electrophoresis (Beyotime, Shanghai, China) and transferred to a polyvinylidene fluoride membrane. 5% bovine serum albumin (Beyotime) was used to block the membrane, which was incubated (overnight; 4 ℃) with the anti-STAT3 (1:1,000; ab68153; Abcam, Cambridge, UK) and anti-phospho (p)-STAT3 (1:2,000; ab76315; Abcam) primary antibodies. The membranes were washed twice with Tris Buffered Saline (containing 0.1% Tween-20) buffer (Solarbio), for 10 min each time, and incubated (2 h; 25 ℃) with goat anti-rabbit antibody (1:20,000, ab205718; Abcam). Anti-GAPDH antibody (1:5,000, ab181602; Abcam) was used as a loading control.
Proliferation assay
Cell Counting Kit-8 (CCK8) reagent (Solarbio; 10 µL) was added to 96-well plates (containing SW480 and SW620; 4×103 cells/well) at 0 h and 72 h, respectively. The absorbance was measured at 490 nm using an enzyme-labeled instrument (Thermo Fisher Scientific) after 60 min incubation in the dark at 20 ℃.
Statistical analysis
Data are presented as mean ± standard deviation (SD) from triplicate experiments. Statistical analysis was performed using one-way Analysis of Variance and Bonferroni post hoc tests. The Student’s t-test was used for independent two-group analyses. Differences were considered significant at P<0.05.
Results
Effect of luteolin on M1 polarization
The RT-qPCR and ELISA results showed that IL-6 expression and secretion increased in macrophages after M1 polarization compared to control macrophages that were not treated with LPS. When treated with different concentrations of luteolin (0, 10, 30, and 60 µM), the expression of IL-6 gradually decreased at the messenger RNA (mRNA) and protein levels (Figure 1A,1B). It is worth noting that no notable differences were observed in IL-6 expression or secretion in response to treatment with 30 or 60 µM of luteolin. Therefore, we chose 30 µM of luteolin as the treatment dose for subsequent experiments.
Luteolin inhibited the effect of M1 macrophages on the SW620 and SW480 cells
To explore the effect of M1 macrophages on colon cancer cells, they were co-cultured with SW620 and SW480 cells for 24 h. The results of ELISA using the supernatant showed that compared with normal cells, M1 macrophages promoted IL-6 secretion from colon cancer cells, and the presence of luteolin inhibited M1 polarization (Figure 1C). The CCK-8 and transwell assay results showed that compared with normal cells, cell proliferation, migration, and invasion induced by M1 macrophages were inhibited by luteolin (Figure 1D,1E). Western blot analysis showed that M1 polarization promoted the phosphorylation of STAT3, while luteolin inhibited M1 polarization (Figure 1F). Therefore, luteolin effectively inhibited the expression of IL-6 mediated by M1 polarization, activation of the STAT3 pathway, and growth of the SW620 and SW480 cells.
Effect of the anti-IL-6 antibody and IL-6 on SW620 and SW480 cells
To confirm the role of the IL-6/STAT3 signaling pathway in M1 polarization, we incubated SW620 and SW480 cells with IL-6 and anti-IL-6 antibodies, respectively. The results revealed although the addition of IL-6 promoted cell proliferation, migration, and invasion, and activated the STAT3 signaling pathway; treatment with the anti-IL-6 antibody had no significant effect on cell function or the STAT3 signaling pathway (Figure 2A-2C).
Anti-IL-6 antibody reversed the effect of IL-6 on M1 polarization
IL-6 and anti-IL-6 antibodies were added to SW620 and SW480 cells (co-cultured with M1 macrophages). The results showed that while IL-6 promoted cell proliferation, migration, and invasion induced by M1 polarization, and activated the STAT3 signaling pathway, the anti-IL-6 antibodies partially inhibited the effect of M1 polarization on cells (Figure 3A-3C).
Similar to luteolin, the anti-IL-6 antibody reversed the effects of IL-6 on M1 polarization
IL-6 and anti-IL-6 antibodies were added to SW620 and SW480 cells (co-cultured with M1 macrophages treated with luteolin). The results showed that luteolin inhibited the M1 polarization and inhibited the proliferation, migration, and invasion of cancer cells by inhibiting STAT3 phosphorylation. The addition of IL-6 reversed the effect of luteolin, while anti-IL-6 antibodies partially inhibited M1 polarization and promoted the therapeutic effect of luteolin (Figure 4A-4C).
Discussion
Evidence-based research on TCM is important for identifying treatment strategies for diseases such as hyperglycemia (29) and atherosclerosis (30-32). Newly generated evidence shows that luteolin exerts anti-cancer effects in colon cancer cells by inducing apoptosis (33,34). However, the correlation between M1 macrophage polarization and luteolin effects remains unknown. In this study, we established an M1 polarization model via PMA-induction of THP-1 cells to explore the effect and mechanism of luteolin on colon cancer cells in terms of immunotherapy. Our results showed that LPS promoted the polarization of macrophages into the M1 phenotype and created an inflammatory environment by inducing the expression and secretion of IL-6 in SW620 and SW480 cells. The anti-inflammatory properties of luteolin prevented the effect of M1 macrophages, suggesting that luteolin inhibits IL-6 production by inhibiting M1 polarization. This result was consistent with those reported by Chen et al. (35).
Cellular immune metabolism may be an important factor in the regulation of macrophage polarization (36). It has also been reported that M1 polarized macrophages promote inflammation by producing the pro-inflammatory factor, IL-6 (37,38). Immune cells present in the inflammatory tumor microenvironment may be key to promoting cancer development (39,40). Therefore, inhibiting macrophage polarization into the M1 phenotype may be the key to preventing the development of colon cancer. In our study, 30 µM of luteolin inhibited M1 polarization, reduced IL-6 expression and secretion, and inhibited SW620 and SW480 cell proliferation, migration, and invasion. In addition, luteolin inhibited the activation of the STAT3 signaling pathway induced by M1 polarization. These results confirmed that luteolin could inhibit the growth and migration of colon cancer cells by mitigating the inflammatory environment.
We also observed that the anti-IL-6 antibody inhibited IL-6 production and secretion as well as M1 polarization under all experimental conditions. Therefore, the effect of luteolin on the inflammatory environment was likely achieved via the IL-6/STAT3 pathway and luteolin may be a promising drug for the prevention and treatment of IL-6-mediated inflammation.
This study has several limitations that should be noted. Firstly, we did not confirm the effects of luteolin in animal models. Secondly, several networks interlinked with the long non-coding RNA-microRNA-mRNA signaling pathway may exert significant effects on the treatment of colon cancer, which were not investigated here. Future studies should focus on these research directions.
In summary, luteolin inhibited the growth, migration, and invasion potential of colon cancer cells caused by M1 polarization by acting on the IL-6/STAT3 signaling pathway. These results provide new insights into the treatment of colon cancer.
Acknowledgments
Funding: This work was supported by the Beijing Medical Health Public Welfare Foundation (grant No. YWJKJJHKYJJ-B17324) and the National Training Program for Innovative Talents of Traditional Chinese Medicine (grant No. Education Letter of the Chinese Medicine Office [2019]-91).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-507/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-507/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-507/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Gupta R, Bhatt LK, Johnston TP, et al. Colon cancer stem cells: Potential target for the treatment of colorectal cancer. Cancer Biol Ther 2019;20:1068-82. [Crossref] [PubMed]
- Recio-Boiles A, Cagir B. Colon Cancer. StatPearls. Treasure Island (FL), 2022.
- Auclin E, Zaanan A, Vernerey D, et al. Subgroups and prognostication in stage III colon cancer: future perspectives for adjuvant therapy. Ann Oncol 2017;28:958-68. [Crossref] [PubMed]
- Wang J, Wong YK, Liao F. What has traditional Chinese medicine delivered for modern medicine? Expert Rev Mol Med 2018;20:e4. [Crossref] [PubMed]
- Oravecz M, Mészáros J. Traditional Chinese medicine: theoretical background and its use in China. Orv Hetil 2012;153:723-31. [Crossref] [PubMed]
- Wang CZ, Wan C, Luo Y, et al. Ginseng berry concentrate prevents colon cancer via cell cycle, apoptosis regulation, and inflammation-linked Th17 cell differentiation. J Physiol Pharmacol 2021; [Crossref] [PubMed]
- Wang Y, Wang Q, Li C, et al. A Review of Chinese Herbal Medicine for the Treatment of Chronic Heart Failure. Curr Pharm Des 2017;23:5115-24. [PubMed]
- Wang X, Yang Y, Liu X, et al. Pharmacological properties of tanshinones, the natural products from Salvia miltiorrhiza. Adv Pharmacol 2020;87:43-70. [Crossref] [PubMed]
- Nabavi SF, Braidy N, Gortzi O, et al. Luteolin as an anti-inflammatory and neuroprotective agent: A brief review. Brain Res Bull 2015;119:1-11. [Crossref] [PubMed]
- Ahmadi SM, Farhoosh R, Sharif A, et al. Structure-Antioxidant Activity Relationships of Luteolin and Catechin. J Food Sci 2020;85:298-305. [Crossref] [PubMed]
- Ding Y, Shi X, Shuai X, et al. Luteolin prevents uric acid-induced pancreatic beta-cell dysfunction. J Biomed Res 2014;28:292-8. [PubMed]
- Imran M, Rauf A, Abu-Izneid T, et al. Luteolin, a flavonoid, as an anticancer agent: A review. Biomed Pharmacother 2019;112:108612. [Crossref] [PubMed]
- Ambasta RK, Gupta R, Kumar D, et al. Can luteolin be a therapeutic molecule for both colon cancer and diabetes? Brief Funct Genomics 2018;18:230-9. [Crossref] [PubMed]
- Wang L, Zhu L, Duan C, et al. Total saponin of Dioscorea collettii attenuates MSU crystal-induced inflammation via inhibiting the activation of the NALP3 inflammasome and caspase-1 in THP-1 macrophages. Mol Med Rep 2020;21:2466-74. [Crossref] [PubMed]
- Li P, Wang H, Shao Q, et al. Fucoidan modulates cytokine production and migration of THP-1-derived macrophages via colony-stimulating factor-1. Mol Med Rep 2017;15:2325-32. [Crossref] [PubMed]
- Zhao W, Ma L, Cai C, et al. Caffeine Inhibits NLRP3 Inflammasome Activation by Suppressing MAPK/NF-κB and A2aR Signaling in LPS-Induced THP-1 Macrophages. Int J Biol Sci 2019;15:1571-81. [Crossref] [PubMed]
- Sun J, Shigemi H, Cao M, et al. Minocycline Induces Autophagy and Inhibits Cell Proliferation in LPS-Stimulated THP-1 Cells. Biomed Res Int 2020;2020:5459209. [Crossref] [PubMed]
- Zhang G, Liao Y, Pan X, et al. Exosomes from HPV-16 E7-pulsed dendritic cells prevent the migration, M1 polarization, and inflammation of macrophages in cervical cancer by regulating catalase 2 (CAT2). Ann Transl Med 2022;10:217. [Crossref] [PubMed]
- Lin Y, He Z, Ye J, et al. Progress in Understanding the IL-6/STAT3 Pathway in Colorectal Cancer. Onco Targets Ther 2020;13:13023-32. [Crossref] [PubMed]
- Hu Z, Luo D, Wang D, et al. IL-17 Activates the IL-6/STAT3 Signal Pathway in the Proliferation of Hepatitis B Virus-Related Hepatocellular Carcinoma. Cell Physiol Biochem 2017;43:2379-90. [Crossref] [PubMed]
- Kitamura H, Ohno Y, Toyoshima Y, et al. Interleukin-6/STAT3 signaling as a promising target to improve the efficacy of cancer immunotherapy. Cancer Sci 2017;108:1947-52. [Crossref] [PubMed]
- Zhao Y, Yao J, Wu XP, et al. Wogonin suppresses human alveolar adenocarcinoma cell A549 migration in inflammatory microenvironment by modulating the IL-6/STAT3 signaling pathway. Mol Carcinog 2015;54:E81-93. [Crossref] [PubMed]
- Pan T, Zhang F, Li F, et al. Shikonin blocks human lung adenocarcinoma cell migration and invasion in the inflammatory microenvironment via the IL-6/STAT3 signaling pathway. Oncol Rep 2020;44:1049-63. [Crossref] [PubMed]
- Pucci M, Raimondo S, Urzì O, et al. Tumor-Derived Small Extracellular Vesicles Induce Pro-Inflammatory Cytokine Expression and PD-L1 Regulation in M0 Macrophages via IL-6/STAT3 and TLR4 Signaling Pathways. Int J Mol Sci 2021;22:12118. [Crossref] [PubMed]
- Xu F, Cui WQ, Wei Y, et al. Astragaloside IV inhibits lung cancer progression and metastasis by modulating macrophage polarization through AMPK signaling. J Exp Clin Cancer Res 2018;37:207. [Crossref] [PubMed]
- Chanput W, Mes JJ, Savelkoul HF, et al. Characterization of polarized THP-1 macrophages and polarizing ability of LPS and food compounds. Food Funct 2013;4:266-76. [Crossref] [PubMed]
- Weng YS, Tseng HY, Chen YA, et al. MCT-1/miR-34a/IL-6/IL-6R signaling axis promotes EMT progression, cancer stemness and M2 macrophage polarization in triple-negative breast cancer. Mol Cancer 2019;18:42. [Crossref] [PubMed]
- Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402-8. [Crossref] [PubMed]
- Xiong C, Wu Q, Fang M, et al. Protective effects of luteolin on nephrotoxicity induced by long-term hyperglycaemia in rats. J Int Med Res 2020;48:300060520903642. [Crossref] [PubMed]
- Ding X, Zheng L, Yang B, et al. Luteolin Attenuates Atherosclerosis Via Modulating Signal Transducer And Activator Of Transcription 3-Mediated Inflammatory Response. Drug Des Devel Ther 2019;13:3899-911. [Crossref] [PubMed]
- Zhang J, Li Y, Zhang B, et al. Evidence-based traditional Chinese medicine research: Beijing Declaration. J Evid Based Med 2020;13:91-2. [Crossref] [PubMed]
- Du H, Lei Y, Gao AN, et al. Traditional Chinese medicine combined with conventional therapy for female kidney stone: A protocol for systematic review. Medicine (Baltimore) 2020;99:e19611. [Crossref] [PubMed]
- Chen Z, Zhang B, Gao F, et al. Modulation of G2/M cell cycle arrest and apoptosis by luteolin in human colon cancer cells and xenografts. Oncol Lett 2018;15:1559-65. [PubMed]
- Potočnjak I, Šimić L, Gobin I, et al. Antitumor activity of luteolin in human colon cancer SW620 cells is mediated by the ERK/FOXO3a signaling pathway. Toxicol In Vitro 2020;66:104852. [Crossref] [PubMed]
- Chen G, Han Y, Feng Y, et al. Extract of Ilex rotunda Thunb alleviates experimental colitis-associated cancer via suppressing inflammation-induced miR-31-5p/YAP overexpression. Phytomedicine 2019;62:152941. [Crossref] [PubMed]
- O'Neill LA, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists. Nat Rev Immunol 2016;16:553-65. [Crossref] [PubMed]
- de Torre-Minguela C, Barberà-Cremades M, Gómez AI, et al. Macrophage activation and polarization modify P2X7 receptor secretome influencing the inflammatory process. Sci Rep 2016;6:22586. [Crossref] [PubMed]
- Lin YK, Yeh CT, Kuo KT, et al. Apolipoprotein (a)/Lipoprotein(a)-Induced Oxidative-Inflammatory α 7-nAChR/p38 MAPK/IL-6/RhoA-GTP Signaling Axis and M1 Macrophage Polarization Modulate Inflammation-Associated Development of Coronary Artery Spasm. Oxid Med Cell Longev 2022;2022:9964689. [Crossref] [PubMed]
- Zhou B, Kang Y, Qi M, et al. R-HPDC Process with Forced Convection Mixing Device for Automotive Part of A380 Aluminum Alloy. Materials (Basel) 2014;7:3084-105. [Crossref] [PubMed]
- Kim J, Bae JS. Tumor-Associated Macrophages and Neutrophils in Tumor Microenvironment. Mediators Inflamm 2016;2016:6058147. [Crossref] [PubMed]
(English Language Editor: A. Kassem)

