Validation of a genotype-based algorithm that identifies individuals with low, intermediate, and high serum CA19-9 levels in cancer-free individuals and in patients with colorectal cancer
Introduction
The carbohydrate antigen, CA19-9 has been evaluated and is used as tumor marker for gastrointestinal cancers (1,2). It is a carbohydrate epitope, which is present on mucins and it might be secreted by plasma cells into the blood plasma by cancer cells (1,3).
CA19-9 biosynthesis depends on the enzymatic activity of fucosyltransferase-2 (FUT2, also known as Secretor) and fucosyltransferase-3 (FUT3, also known as Lewis)(4,5). Individuals who do not have FUT3 activity are unable to express the CA19-9 epitope irrespective of FUT2 activity. Contrary, inactivity of FUT2 results in higher CA19-9 serum levels (4-6). The activity of both enzymes is determined by the FUT2 and FUT3 genotype (5), and several single nucleotide polymorphisms (SNPs) affecting enzyme activity are known (6).
In a large study on patients with primary sclerosing cholangitis (PSC), we developed a grouping algorithm based on the results of the FUT2 and FUT3 genotyping, which classified patients as having either low, intermediate, or high CA19-9 biosynthetic activity. In these PSC patients, the CA19-9 levels in serum were considerably different between these groups, and screening for biliary tract cancer was improved (6). Similar evidence has recently been reported for pancreatic adenocarcinoma (7). CA19-9 was further linked to the FUT3-FUT6 gene cluster and the FUT2 gene in a genome-wide association study (8). Additionally, FUT2 was identified as a risk gene in PSC and a FUT2 knockout caused liver disease in mice (9-11).
This study was set up to (I) validate our previously developed grouping algorithm in cancer-free controls, (II) to investigate further improvements of the grouping algorithm, and (III) to evaluate influence of FUT2 and FUT3 genotype on serum CA19-9 levels in patients with colorectal cancer (CRC). We present the following article in accordance with the MDAR reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-310/rc).
Methods
Study design
Patients with and without colorectal cancer were included in this study. These patients were selected from two large cohort studies evaluating colorectal cancer screening in southern Germany. Cancer-free individuals were selected from the the BliTz study (Begleitende Evaluierung innovativer Testverfahren zur Darmkrebsfrüherkennung), which included patients who underwent screening colonoscopy. Patients with colorectal cancer were identified from the DACHS+ study, a substudy of the DACHS study (Darmkrebs: Chancen der Verhütung durch Screening) that included patients with confirmed colorectal cancer.
Serum CA19-9 levels were measured, and FUT genotyping was performed for the included patients. Additionally, basic demographic and health characteristics of all patients were included.
During course of the study, inclusion of a cohort of patients with PSC for the validation of results was decided. These patients were identified from a local study database, that already served as basis for previous studies on FUT genotype and its association with CA19-9 and carcinoembryonic antigen (6,12-14).
The study was previously approved by the Ethics Committee of the Medical Faculty of University Heidelberg (study ID: S-043/2011), and was conducted in accordance with the Declaration of Helsinki (as revised in 2013). All participants provided written informed consent prior to inclusion in the BliTz or the DACHS+ study or the PSC patient database.
Patient selection
The cancer-free control patients were selected from the BliTz study, which is aimed to evaluate new tests for the early detection of CRC, as described in previous publications (15-21). As part of the German screening colonoscopy program, a screening colonoscopy is offered to persons who are 55 years of age or older with average risk. Individuals who underwent the screening colonoscopy as part of the program were invited to participate in the study. Participants provided samples of blood and stool for evaluation of novel screening tests for CRC. Patients were screened and recruited during a preparatory visit for screening colonoscopy. The study was conducted in 20 gastroenterology institutions in southern Germany. Cancer-free patients without a pre-colonoscopy blood sample and CRC patients without a pre-operative blood sample were excluded. Those cancer-free patients with neoplastic or hyperplastic polyps, which were detected during colonoscopy and those patients with incomplete colonoscopy or inadequate bowel preparation were further excluded.
The colorectal cancer patients were recruited from the DACHS+ study, a substudy of the DACHS study (20-24). DACHS is an ongoing case-control study that focuses on the role of colonoscopy in CRC prevention. The substudy, DACHS+, included patients with CRC, who were referred by general practitioners or gastroenterologists for surgery at one of four participating hospitals between 2006 and 2016. Patients who received neoadjuvant therapy before sample collection were excluded from this study.
From the remaining study subjects, patients were randomly selected for inclusion in the current analysis. Cancer free patients were not matched to the CRC patients.
Final study cohort
Of the 400 patients initially screened for eligibility, 338 were finally included in the current analysis (Figure 1). Of these patients, 177 (52.4%) were assigned to the control cohort, while 161 (47.6%) were diagnosed with CRC. The cancer stages [according to diseases stages defined by the Union internationale contre le cancer (UICC)] were stage 0 in 1 (0.6%), stage I in 42 (26.1%), stage II in 46 (28.6), stage III in 53 (32.9%) and stage IV in 19 (11.8%) of the patients (Table 1).
Table 1
| Characteristics | Cancer-free (n=177) | CRC (n=161) | P |
|---|---|---|---|
| Age, years (±SD) | 62.5 (±6.8) | 68.4 (±11.4) | <0.001 |
| Sex, male, n (%) | 76 (42.9) | 94 (58.4) | 0.005 |
| Regular cigarette smoking, n (%) | 0.014 | ||
| Never | 109 (61.9) | 79 (56.4) | |
| Former | 46 (26.1) | 54 (38.6) | |
| Currently | 21 (11.9) | 7 (5.0) | |
Information on smoking behavior was not available for all patients.
Measurement of CA19-9 levels
An enzyme-linked immunosorbent assay (ELISA) test (Abnova, Taipei, Taiwan) was used for measuring CA19-9 levels in serum samples from the primary study cohort. It was used according to the manufacturer’s instructions.
Genotyping for FUT2 and FUT3
In all patients, genotyping was performed for the following allelic variants: rs601338 (G428A) in FUT2 and rs778986 (C314T), rs812936 (T202C), rs3894326 (T1067A), and rs28362459 (T59G) in FUT3. The following methods were used in the central laboratory of the Heidelberg University Hospital. Genomic DNA was extracted from whole blood samples using the QIAamp DNA Blood Midi Kit (Qiagen, Hilden, Germany). DNA was analyzed using LightCycler 2.0 (Roche, Mannheim, Germany) with LightSNiP assays from TibMolBiol (Berlin, Germany) for rs601338, rs812936, rs778986, and rs28362459 according to the manufacturer's instructions. The analysis of rs3894326 was performed by Sanger sequencing using an ABI PRISM 310 Genetic Analyzer (Applied Biosystems, Darmstadt, Germany), and the sequences of the forward and reverse primers used are 5’ACCTGAGCTACTTTCGCTGG3’ and 5’CAAAGGACTCCAGCAGGTGA3’, respectively. For individual cases, 5’GCCCCAGGCAGATGAGG3’ was used as an alternative reverse primer.
Patient classification based on the FUT genotypes
Patients were assigned to one of the three groups based on the results of the FUT2 and FUT3 genotyping, as described previously (6,13). These groups represented patients with low (group A), intermediate (group B), or high (group C) CA19-9 biosynthetic activity that was genetically determined. For grouping purposes, the enzyme activity of FUT2 and FUT3 in a patient was estimated based on his FUT2 and FUT3 genotype. All patients with an expected loss of FUT3 enzyme activity were assigned to group A. Patients with expected normal or only partly reduced FUT3 enzyme activity were assigned to group C in case of an expected loss of FUT2 activity, or to group B in case of normal or partly reduced activity of FUT2.
Group A comprised all those patients carrying a homozygous FUT3 mutation (C314T, T202C, or T1067A) that results in the loss of enzymatic activity and consequently, very low serum CA19-9 levels (25,26). Individuals who were heterozygous for more than one FUT3 SNP were assumed to be heterozygous and to have FUT3 enzymatic activity provided that their allele status matched one of the seven FUT3 alleles described by Orntoft et al. (27). Therefore, these patients were assigned to groups B or C depending on the FUT2 status. If the FUT2 status did not match any one of these alleles, the patients were considered to be compound heterozygous and have loss of enzyme activity, and were assigned to group A. Patients with homozygous mutations for T59G in FUT3 were only assigned to group A, if at least one concomitant heterozygous mutation for one of the four other FUT3 SNPs was present, since only this results in the loss of enzymatic activity (28). The FUT2 genotype was not needed for the grouping of patients to group A.
Patients who did not meet the criteria for allocation to group A based on the FUT3 genotype were assigned to groups B or C depending on the FUT2 gene. Of these patients, group C consisted of all those patients with a homozygous FUT2 mutation, that resulted in higher serum CA19-9 levels (4,29), while those with either a wild-type or heterozygous FUT2 allele status were assigned to group B (Figure 2).
Statistical analysis
Results are presented either as ordinary numbers or as median with interquartile range (IQR). Chi-square test was used for comparison of categorical data, and Mann-Whitney-U and Kruskal-Wallis tests were used for the comparison of non-normally distributed data. A receiver operating characteristic (ROC) analysis with calculation of the area under the curve (AUC) was done. A P value <0.05 was considered to be statistically significant. All analyses were performed using SPSS Statistics version 24 (IBM Corp., Armonk, NY, USA), and graphs were plotted using Prism version 5 (GraphPad Software Inc., La Jolla, CA, USA).
Results
Results of the FUT2 and FUT3 genotyping and allocation to groups based on CA19-9 biosynthesis
Of the cancer-free patients, n=14 (7.9%) of the patients were assigned to group A, n=134 (75.7%), to group B, and the remaining n=29 (16.4%), to group C. Patients with colorectal cancer were grouped in a similar manner. Of these patients, n=12 (7.5%) were assigned to group A, n=124 (77.0%) to group B, and n=25 (15.5%) to group C (P=0.961 between the two cohorts). Detailed results of the genotyping for the single FUT2 SNP and the 4 FUT3 SNPs are provided in Table 2.
Table 2
| SNP | Healthy controls (n=177) | Cancer patients (n=161) | P |
|---|---|---|---|
| rs601338 FUT2 (G428A) | 0.780 | ||
| Wild-type | 58 (32.8%) | 52 (32.3%) | |
| Heterozygous mutated | 87 (49.2%) | 84 (52.2%) | |
| Homozygous mutated | 32 (18.1%) | 25 (15.5%) | |
| rs812936 FUT3 (T202C) | 0.529 | ||
| Wild-type | 97 (54.8%) | 98 (60.9%) | |
| Heterozygous mutated | 70 (39.5%) | 55 (34.2%) | |
| Homozygous mutated | 10 (5.6%) | 8 (5.0%) | |
| rs778986 FUT3 (C314T) | 0.635 | ||
| Wild-type | 101 (57.1%) | 100 (62.1%) | |
| Heterozygous mutated | 68 (38.4%) | 55 (34.2%) | |
| Homozygous mutated | 8 (4.5%) | 6 (3.7%) | |
| rs3894326 FUT3 (T1067A) | 0.065 | ||
| Wild-type | 162 (91.5%) | 137 (85.1%) | |
| Heterozygous mutated | 15 (8.5%) | 24 (14.9%) | |
| Homozygous mutated | 0 | 0 | |
| rs28362459 FUT3 (T59G) | 0.037 | ||
| Wild-type | 151 (85.3%) | 123 (76.4%) | |
| Heterozygous mutated | 26 (14.7%) | 38 (23.6%) | |
| Homozygous mutated | 0 | 0 |
SNP, single nucleotide polymorphism.
Serum levels of CA19-9 levels in the control cohort
The overall median serum level of CA19-9 was 11.67 U/mL in the cancer-free patients (IQR: 4.33–21.99). The median CA19-9 levels were 1.41 U/mL (IQR: 0.00–5.75) in the group A patients, 10.09 U/mL (IQR: 4.30–20.50) in the group B patients, and 23.12 U/mL (IQR: 16.12–32.90) in the group C patients (P<0.001).
Analysis of the influence of the SNPs in FUT2 and FUT3 on serum levels of CA19-9 in each of the three groups organized on the basis of CA19-9 biosynthetic activity
In patients with intermediate CA19-9 biosynthetic activity (group B), a tendency of the influence of the T202C and C314T variants on CA19-9 levels was observed. Higher serum CA19-9 levels were found in those patients with the wild-type genotype than those with a heterozygous mutation (P=0.097 and P=0.099, respectively). In group B, the T59G variant further exerted a substantial influence on serum CA19-9 levels. In group B patients, who possessed the wild-type genotype for T59G, the median CA19-9 level was 10.42 U/mL (IQR: 4.80–20.92) and in those patients with a heterozygous mutation for the T59G variant, the value was 5.32 U/mL (IQR: 0.19–13.23, P=0.014) (Figure 3). No such differences were observed in serum CA19-9 levels of patients in groups A and C with regard to any of the included FUT2 and FUT3 SNPs,
Modification of the grouping algorithm
Based on the aforementioned findings, the initial grouping algorithm was modified, by which group B was subdivided into two groups. Patients, who were originally assigned to group B, and heterozygous for T202C, C314T, or T59G, were now assigned to group B1, while those with the wild-type alleles of the three SNPs were assigned to group B2. The median CA19-9 level in the patients of group B1 was 7.24 U/mL (IQR: 3.16–15.00) and that in the patients of group B2 was 13.29 U/mL (IQR: 6.14–24.46); the difference was statistically significant (P=0.005).
Serum CA19-9 levels in patients with CRC
The median serum CA19-9 level in patients with colorectal cancer was 15.52 U/mL (IQR: 9.10–34.09), which was significantly lower than that of the controls (P<0.001). In groups A, B, and C, the median C19-9 levels were 1.52 U/mL (IQR: 0.59–13.71), 13.92 U/mL (IQR: 9.09–32.07), and 26.83 U/mL (IQR: 16.61–47.57), respectively (P<0.001 between groups). There was no difference in CA19-9 level between the controls and the CRC patients within groups A (P=0.404) or C (P=0.152); however, a significant difference was present in group B patients (P<0.001).
An AUC of 0.622 (95% CI: 0.563–0.682, P<0.001) for CA19-9 level was shown by the ROC analysis to distinguish the CRC patients from the cancer-free patients (Table 3). By applying the modified grouping algorithm to the patients with colorectal cancer, the medians were found to be 12.78 U/mL (IQR: 7.47–31.28) in group B1 patients and 15.72 U/mL (10.03–43.60) in group B2 patients, respectively. The difference was not statistically significant; however, there was a trend towards higher CA9-9 levels in the patients of group B2 (P=0.101). Using the modified grouping algorithm, an AUC of 0.665 (0.575–0.756. P=0001) for group B1, and an AUC of 0.625 (0.526–0.725. P=0.018) for group B2 were obtained (Figure 4A).
Table 3
| Group | ROC | |
|---|---|---|
| AUC (95% CI) | P | |
| All patients | 0.622 (0.563–0.682) | <0.001 |
| Group A | 0.595 (0.369–0.821) | 0.411 |
| Group B | 0.640 (0.573–0.707) | <0.001 |
| Group B1 | 0.665 (0.575–0.756) | 0.001 |
| Group B2 | 0.625 (0.526–0.725) | 0.018 |
| Group C | 0.614 (0.459–0.768) | 0.152 |
ROC, receiver operated characteristic; AUC, area under the curve; 95% CI, 95% confidence interval.
Application of the modified grouping algorithm to patients with primary sclerosing cholangitis
After the exclusion of patients with missing genotype data (n=53) and extrabiliary malignancies (n=18), and without an available CA19-9 value (n=19), 212 PSC patients were finally included, among which 17 patients were diagnosed with biliary tract cancer. Allocation of patients to the three groups according to the genotype determining CA19-9 biosynthetic activity was as follows: group A with n=20 (9.4%), group B with n=148 (69.8%), and group C with n=44 (20.8%). By applying the modified grouping algorithm, 84 (39.6%) patients were allocated to group B1, and 64 (30.2%) patients were allocated to group B2.
Of the 148 patients of group B, 14 (9.5%) had diagnosis of biliary tract cancer. The median serum CA19-9 level in these patients was 95.35 U/mL (IQR: 38.45–405.73), which was significantly higher than the median CA19-9, 15.00 U/mL (IQR: 7.89–31.80) in the 134 cancer-free patients (P<0.001). No difference in CA19-9 level was found among the cancer-free patients of group B1 (median: 14.60 U/mL, IQR: 7.50–29.00) compared to those of group B2 (median: 15.40 U/mL, IQR: 8.00–33.40, P=0.487). Accordingly, only minor differences in the AUC values obtained by the ROC analysis were seen in the original group B and the modified groups B1 and B2: the AUC values were 0.897 (95% CI: 0.787–0.975, P<0.001) in group B, 0.927 (95% CI: 0.860–0.993, P=0.001) in group B1, and 0.846 (95% CI: 0.697–0.996, P=0.001) in group B2 (Figure 4B).
Discussion
The main result of this study is that we were able to validate the previously published genotype-based grouping algorithm that identifies individuals with low, intermediate, or high CA19-9 biosynthetic activity (6). This was done in two further cohorts, namely, one consisting of colorectal cancer patients and, most importantly, another with cancer-free controls. In both cohorts, there were significant differences in serum CA19-9 levels among the three groups. After the initial evaluation of the algorithm in PSC patients with and without concomitant biliary tract cancer, similar results were recently reported for patients with pancreatic diseases including pancreatic adenocarcinoma (6,7). Based on those results and especially on the algorithm validation in the control cohort of cancer-free patients in the current study, we conclude that the grouping algorithm truly distinguishes between individuals with different serum CA19-9 levels.
In the current study, our aim was to improve the previously developed algorithm. Our analysis revealed that the T59G variant of the FUT3 gene had a significant influence on serum levels of CA19-9 in the patients of the group with the genotype determining intermediate biosynthetic activity. While this finding resulted in the creation of two groups with distinct serum CA19-9 levels in the healthy controls (groups B1 and B2), the modified grouping algorithm including these two subgroups could not be validated in CRC patients and in PSC patients who were included additionally. Noteworthy, the majority of PSC patients included in this study were as well included in a previous analysis used to develop the grouping algorithm (6), however, the modified algorithm (including B1 and B2) had not been tested in these patients before. Nevertheless, an independent group of PSC patients to further validate this finding would be of scientific interest. The modified grouping algorithm did not help to further increase the AUC value obtained by the ROC analysis for the detection of cholangiocarcinoma (CCA) in PSC patients. Thus, we conclude that at least with the currently used selection of FUT2 and FUT3 SNPs, further clinically relevant improvements cannot be made to the grouping algorithm. We therefore advocate the further use and investigation of the current algorithm, if possible, in prospective studies.
The use of CA19-9 either alone or in conjunction with the grouping based on genotype was not sufficient to distinguish between the patients with and without CRC, as could be expected. This insufficiency in the use of CA19-9 for screening for CRC has previously been shown (30) and our study indicates that screening cannot be improved by inclusion of FUT genotyping. Regarding good scientific practice, this negative result is nevertheless worth publishing. In contrast to the carcinoembryonic antigen, the use of which is recommended for surveillance after primary diagnosis, the use of CA19-9 is not recommended in international guidelines (31-33). Unfortunately measurement of CEA, which was previously shown to be influenced by FUT2 genotype as well (13), could not be conducted in the cohort of CRC patients do to limited sample volume available. Further, this study did not aim at investigating the application of CA19-9 in combination with FUT genotyping as a tool for screening for CRC, especially as colonoscopy is a well-established and efficient technique for CRC screening (34), but to validate the grouping algorithm per se. In contrast to previous studies on PSC and CCA, this study has the great advantage of including cancer-free individuals without an underlying diagnosis of PSC and CRC is a much more common cancer compared to biliary tract cancers. In contrast to CRC, the grouping algorithm might aid in the diagnosis (or even screening) of cancers such as pancreatic adenocarcinoma or CCA, especially in high-risk patients such as patients suffering from PSC or chronic pancreatitis (6,7,35).
Regarding results from this and from previous studies, the following clinically relevant conclusion can be drawn. In approximately 10% of patients (i.e., those belonging to Group A) CA19-9 is probably not useful as a tumor marker, neither for screening nor for follow-up surveillance, as these patients are genetically incapable of CA19-9 synthesis. However, a recent study indicated that raised CA19-9 values might be observed in case of pancreatic cancer in these patients as well. This might indicate that measurable CA19-9 values in these patients should raise even more suspicion (36). In contrast, patients belonging to Group C (approx. 15–20% of patients) show higher CA19-9 values than other patients, despite not having malignancy. Especially in patients with chronic pancreatico-biliary disease and an increased risk of either pancreatic adenocarcinoma or biliary tract cancer, higher cut-off values might be beneficial in these patients. Overall, these genetic determined inter-individual variance in CA19-9 indicates, that intra-individual changes are likely more important and reliable than absolute values (37). Data on the use of FUT-genotype-depended CA19-9 cut-off values in patients with chronic pancreatitis and PSC, indicate that their use might result in genotype-depended cut-off values with increases in sensitivity and specificity as well as a reduction in false-positive tests (6,7,35).
Conclusions
In summary, we validated a grouping algorithm that distinguishes patients with low, intermediate, and high CA19-9 biosynthetic activity based on the genotyping for FUT2 and FUT3 in this retrospective study. No further additional subgroup of clinical relevance could be identified. Even though the application of the grouping algorithm did not lead to an improvement in the accuracy of diagnosis using CA19-9 in the case of colorectal cancer detection, the validation performed in this study promotes its further application and investigation in patients with a high risk of gastrointestinal cancers such as pancreatic adenocarcinoma or biliary tract cancer.
Acknowledgments
The authors thank Petra Klöters-Plachky and Yvonne Leopold for their help with sample handling and preparation.
Funding: The BliTz study was partly funded by grants from the German Research Council (DFG, grant No. BR1704/16-1).
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-310/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-310/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-22-310/coif). AW is co-owner of a patent for a medical analysis system assessing the risk of cancer based upon CA19-9 or CEA and FUT2- and FUT3 genotype. HB reports funding from German Research Council (DFG). DNG is co-owner of a patent for a medical analysis system assessing the risk of cancer based upon CA19-9 or CEA and FUT2- and FUT3 genotype. The other authors have no conflicts of interest to declare.
Ethical Statement:
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Lee T, Teng TZJ, Shelat VG. Carbohydrate antigen 19-9 - tumor marker: Past, present, and future. World J Gastrointest Surg 2020;12:468-90. [Crossref] [PubMed]
- Duffy MJ. CA 19-9 as a marker for gastrointestinal cancers: a review. Ann Clin Biochem 1998;35:364-70. [Crossref] [PubMed]
- Magnani JL, Steplewski Z, Koprowski H, et al. Identification of the gastrointestinal and pancreatic cancer-associated antigen detected by monoclonal antibody 19-9 in the sera of patients as a mucin. Cancer Res 1983;43:5489-92. [PubMed]
- Narimatsu H, Iwasaki H, Nakayama F, et al. Lewis and secretor gene dosages affect CA19-9 and DU-PAN-2 serum levels in normal individuals and colorectal cancer patients. Cancer Res 1998;58:512-8. [PubMed]
- Mollicone R, Reguigne I, Kelly RJ, et al. Molecular basis for Lewis alpha(1,3/1,4)-fucosyltransferase gene deficiency (FUT3) found in Lewis-negative Indonesian pedigrees. J Biol Chem 1994;269:20987-94. [Crossref] [PubMed]
- Wannhoff A, Hov JR, Folseraas T, et al. FUT2 and FUT3 genotype determines CA19-9 cut-off values for detection of cholangiocarcinoma in patients with primary sclerosing cholangitis. J Hepatol 2013;59:1278-84. [Crossref] [PubMed]
- Luo G, Guo M, Jin K, et al. Optimize CA19-9 in detecting pancreatic cancer by Lewis and Secretor genotyping. Pancreatology 2016;16:1057-62. [Crossref] [PubMed]
- He M, Wu C, Xu J, et al. A genome wide association study of genetic loci that influence tumour biomarkers cancer antigen 19-9, carcinoembryonic antigen and α fetoprotein and their associations with cancer risk. Gut 2014;63:143-51. [Crossref] [PubMed]
- Folseraas T, Melum E, Rausch P, et al. Extended analysis of a genome-wide association study in primary sclerosing cholangitis detects multiple novel risk loci. J Hepatol 2012;57:366-75. [Crossref] [PubMed]
- Maroni L, van de Graaf SF, Hohenester SD, et al. Fucosyltransferase 2: a genetic risk factor for primary sclerosing cholangitis and Crohn's disease--a comprehensive review. Clin Rev Allergy Immunol 2015;48:182-91. [Crossref] [PubMed]
- Maroni L, Hohenester SD, van de Graaf SFJ, et al. Knockout of the primary sclerosing cholangitis-risk gene Fut2 causes liver disease in mice. Hepatology 2017;66:542-54. [Crossref] [PubMed]
- Wannhoff A, Rupp C, Friedrich K, et al. Inflammation But Not Biliary Obstruction Is Associated With Carbohydrate Antigen 19-9 Levels in Patients With Primary Sclerosing Cholangitis. Clin Gastroenterol Hepatol 2015;13:2372-9. [Crossref] [PubMed]
- Wannhoff A, Folseraas T, Brune M, et al. A common genetic variant of fucosyltransferase 2 correlates with serum carcinoembryonic antigen levels and affects cancer screening in patients with primary sclerosing cholangitis. United European Gastroenterol J 2016;4:84-91. [Crossref] [PubMed]
- Wannhoff A, Rupp C, Friedrich K, et al. Carcinoembryonic Antigen Level in Primary Sclerosing Cholangitis Is Not Influenced by Dominant Strictures or Bacterial Cholangitis. Dig Dis Sci 2017;62:510-6. [Crossref] [PubMed]
- Hundt S, Haug U, Brenner H. Comparative evaluation of immunochemical fecal occult blood tests for colorectal adenoma detection. Ann Intern Med 2009;150:162-9. [Crossref] [PubMed]
- Brenner H, Haug U, Hundt S. Sex differences in performance of fecal occult blood testing. Am J Gastroenterol 2010;105:2457-64. [Crossref] [PubMed]
- Brenner H, Haug U, Hundt S. Inter-test agreement and quantitative cross-validation of immunochromatographical fecal occult blood tests. Int J Cancer 2010;127:1643-9. [Crossref] [PubMed]
- Brenner H, Tao S, Haug U. Low-dose aspirin use and performance of immunochemical fecal occult blood tests. JAMA 2010;304:2513-20. [Crossref] [PubMed]
- Haug U, Hundt S, Brenner H. Quantitative immunochemical fecal occult blood testing for colorectal adenoma detection: evaluation in the target population of screening and comparison with qualitative tests. Am J Gastroenterol 2010;105:682-90. [Crossref] [PubMed]
- Tao S, Haug U, Kuhn K, et al. Comparison and combination of blood-based inflammatory markers with faecal occult blood tests for non-invasive colorectal cancer screening. Br J Cancer 2012;106:1424-30. [Crossref] [PubMed]
- Tao S, Brenner H. Well adjusted qualitative immunochemical faecal occult blood tests could be a promising alternative for inexpensive, high-quality colorectal cancer screening. Eur J Cancer Prev 2013;22:305-10. [Crossref] [PubMed]
- Brenner H, Chang-Claude J, Seiler CM, et al. Does a negative screening colonoscopy ever need to be repeated? Gut 2006;55:1145-50. [Crossref] [PubMed]
- Brenner H, Chang-Claude J, Seiler CM, et al. Case-control study supports extension of surveillance interval after colonoscopic polypectomy to at least 5 yr. Am J Gastroenterol 2007;102:1739-44. [Crossref] [PubMed]
- Brenner H, Chang-Claude J, Seiler CM, et al. Protection from colorectal cancer after colonoscopy: a population-based, case-control study. Ann Intern Med 2011;154:22-30. [Crossref] [PubMed]
- Elmgren A, Mollicone R, Costache M, et al. Significance of individual point mutations, T202C and C314T, in the human Lewis (FUT3) gene for expression of Lewis antigens by the human alpha(1,3/1,4)-fucosyltransferase, Fuc-TIII. J Biol Chem 1997;272:21994-8. [Crossref] [PubMed]
- Salomaa V, Pankow J, Heiss G, et al. Genetic background of Lewis negative blood group phenotype and its association with atherosclerotic disease in the NHLBI family heart study. J Intern Med 2000;247:689-98. [Crossref] [PubMed]
- Orntoft TF, Vestergaard EM, Holmes E, et al. Influence of Lewis alpha1-3/4-L-fucosyltransferase (FUT3) gene mutations on enzyme activity, erythrocyte phenotyping, and circulating tumor marker sialyl-Lewis a levels. J Biol Chem 1996;271:32260-8. [Crossref] [PubMed]
- Cakir B, Pankow JS, Salomaa V, et al. Distribution of Lewis (FUT3)genotype and allele: frequencies in a biethnic United States population. Ann Hematol 2002;81:558-65. [Crossref] [PubMed]
- Kelly RJ, Rouquier S, Giorgi D, et al. Sequence and expression of a candidate for the human Secretor blood group alpha(1,2)fucosyltransferase gene (FUT2). Homozygosity for an enzyme-inactivating nonsense mutation commonly correlates with the non-secretor phenotype. J Biol Chem 1995;270:4640-9. [Crossref] [PubMed]
- Hundt S, Haug U, Brenner H. Blood markers for early detection of colorectal cancer: a systematic review. Cancer Epidemiol Biomarkers Prev 2007;16:1935-53. [Crossref] [PubMed]
- Labianca R, Nordlinger B, Beretta GD, et al. Early colon cancer: ESMO Clinical Practice Guidelines for diagnosis, treatment and follow-up. Ann Oncol 2013;24:vi64-72. [Crossref] [PubMed]
- Locker GY, Hamilton S, Harris J, et al. ASCO 2006 update of recommendations for the use of tumor markers in gastrointestinal cancer. J Clin Oncol 2006;24:5313-27. [Crossref] [PubMed]
- Meyerhardt JA, Mangu PB, Flynn PJ, et al. Follow-up care, surveillance protocol, and secondary prevention measures for survivors of colorectal cancer: American Society of Clinical Oncology clinical practice guideline endorsement. J Clin Oncol 2013;31:4465-70. [Crossref] [PubMed]
- Zauber AG, Winawer SJ, O'Brien MJ, et al. Colonoscopic polypectomy and long-term prevention of colorectal-cancer deaths. N Engl J Med 2012;366:687-96. [Crossref] [PubMed]
- Wannhoff A, Weiss KH, Hackert T, et al. Comment re: "Optimize CA19-9 in detecting pancreatic cancer by Lewis and Secretor genotyping". Pancreatology 2017;17:354-5. [Crossref] [PubMed]
- Luo G, Fan Z, Cheng H, et al. New observations on the utility of CA19-9 as a biomarker in Lewis negative patients with pancreatic cancer. Pancreatology 2018;18:971-6. [Crossref] [PubMed]
- Wannhoff A, Brune M, Knierim J, et al. Longitudinal analysis of CA19-9 reveals individualised normal range and early changes before development of biliary tract cancer in patients with primary sclerosing cholangitis. Aliment Pharmacol Ther 2019;49:769-78. [Crossref] [PubMed]

