Silencing proline-rich coiled-coil 2C inhibit the proliferation and metastasis of liver cancer cells
Highlight box
Key findings
• knockdown of PRRC2C could inhibit the proliferation and induce apoptosis of human hepatocarcinoma cell lines while reducing tumorigenicity of HCC cells in nude mice.
What is known and what is new?
• PRRC2C is an important stress granules protein.
• PRRC2C promotes the proliferation and metastasis of liver cancer cells and inhibited apoptosis, potentially through upregulation of EMT related N-cadherin and Vimentin.
What is the implication, and what should change now?
• PRRC2C may be relevant to the occurrence and development of liver cancer and may be used as an intervention target.
Introduction
Globally, the incidence and mortality of hepatocellular carcinoma (HCC) remain high. Up to 2018 (1), 841,000 new cases and 786,000 cases of liver cancer-related deaths, accounted for 8.2% of total cancer-related deaths, were reported worldwide. Due to the occult onset and high malignant degree, patients were often diagnosed at advanced stages and has less than 16% overall 5-year survival rate (2). However, the effective curable therapies only for early HCC, so poor prognosis remains a challenge that needs to be solved. Identification of specific tumor molecular markers may help earlier diagnosis, as well as further understanding of the molecular mechanism that mediates HCC tumorigenesis. In recent years, there have been a number of studies on molecular mechanisms of liver cancer, such as FAM83D, which promotes the proliferation and migration of hepatocellular carcinoma cells by inhibiting the FBXW7/MCL1 pathway (3).
mRNA processing, transport, translation, and eventually degradation involve a large variety of dedicated protein complexes that commonly assemble into large membraneless structures such as stress granules (SGs). PRRC2C is an important stress granules protein (4). Proline-rich coiled-coil 2C (PRRC2C, or KIAA1096) was highly expression in the adult spinal cord, followed by the adult liver, brain, lung, and ovary, and fetal liver and brain (5). It has been identified as cancer related gene. The gene is located in the chromosome region lq23-24, which was frequently undergoes chromosomal gain in bladder tumors, and upregulation of this gene has been found to be associated with bladder tumor and invasive lesions (6). In addition, alternative splicing of PRRC2C was suggested to be related with lung adenocarcinoma (7); and mutation of PRRC2C was reported to be associated with Endemic Burkitt lymphoma (8). The expression of PRRC2C protein showed a tendency to be present in Serum of preeclampsia patients (9). The similar chromosome region has been reported to have frequent amplification in HCC (10), however the involvement and function of PRRC2C have not been explored in HCC. Therefore, we analyzed its correlation with HCC by screening TCGA database in this study and the functions of PRRC2C in HCC cell behaviors were explored in cellular experiments and xenograft animal models. We present the following article in accordance with the ARRIVE reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-23-10/rc).
Methods
Cell culture
Four liver cancer cells (BEL-7402, BEL-7404, SMMC-7721, and Hep G2) were purchased from Shanghai Cell Bank of Chinese Academy of Sciences. The cells were supplemented with 100 mL/L FBS in 50 mL/L CO2 at 37 ℃ in Dulbecco’s Modified Eagle’s Medium (DMED; Corning, Wu jiang, China).
The cancer genome atlas data analysis
We analyzed the difference between PRRC2C mRNA levels in 371 liver cancer and 50 normal liver tissue using the TCGA database portal (http://cancergenome.nih.gov/), as well as PRRC2C among different Tumor Nodes Metastases (TNM) stage and pathological grades. The correlation between overall survival (OS) and the PRRC2C high or low expression also be analyzed by using Kaplan-Meier survival analysis. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).
PRRC2C gene knockdown in BEL-7404 and SMMC-7221 cells
To silence PRRC2C, shRNA construct containing targeted siRNA oligo “5'-GCTGTATTATCTGGCTATT-3'” was synthesized by Genechem company (Shanghai, China) and cloned into GV115 plasmid vector (Genechem, shanghai, China). The plasmid was packed into lentivirus and transfected into cells using transfection reagents (Genechem, Shanghai, China) according to manufacturer’s instructions. The efficiency of transfection was confirmed by detecting the fluorescence (introduced by eGFP gene in the plasmid vector) at 72-h after lentivirus infection.
RNA isolation and reverse transcription polymerase chain reaction (RT-PCR)
We used TRIZOL reagent (Pufei, Shanghai, China) to isolate total RNA from cell culture samples, and reverse transcriptions were performed by using the Promega M-MLV kit (Promega, Beijing, China). The real-time RT-PCR was performed using the SYBR Master Mix (Takara, Otsu, Japan) according to the manufacturer’s instructions. Primers are listed in Table 1. The 2-△△Ct method was used to calculate the relative mRNA expression.
Table 1
| Primer information | Upstream primer sequence | Downstream primer sequence |
|---|---|---|
| Reference GAPDH (glyceraldehyde-3-phosphate dehydrogenase) | TGACTTCAACAGCGACACCCA | CACCCTGTTGCTGTAGCCAAA |
| Target PRRC2C (proline-rich coiled-coil 2C) | CCATCAGTAGCAAAAGTTCCC | CTTCGCTCTTCCTCTTCACG |
PCR, polymerase chain reaction.
Western blotting
In briefly, total protein was isolated from cells and concentration was determined using BCA assay. Equal amounts of proteins (20 µg) were resolved by 10% SDS-PAGE and then transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA, USA). Before the membrane was incubated overnight at 4 ℃ with the primary antibody, we blocking protein for 1h with 5% non-fat milk, and then incubated with secondary antibodies. The primary antibodies used for western blotting as follows: N-cadherin Mouse Anti-Flag (1:2,000, Sigma, F1804), Mouse anti-GAPDH (1:2,000, Santa-Cruz sc-32233), anti-rabbit IgG antibody (1:5,000; Santa-Cruz, sc-2005).
Cell counts
Cells were seeded into 96-well plates with a density of 2,000 cells/well and cultured at 37 ℃ in a humidified atmosphere with 5% CO2. After culturing 24 h, the number of cells were counted with a Celigo Image Cytometer (Nexcelom, Lawrence, MA USA). All experiments were repeated three times.
MTT assay
5 mg/mL 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT, 20 µL/well) was added to medium and the cells were incubated at 37 ℃ for 4–6 h, 100 µL DMSO solution was added to each well and cells were incubated for another 5 min with constant shaking after aspirating the supernatant. The absorbance (A) at 490 nm was measured using a spectrophotometric plate reader (Thermo, USA, Nanodrop 2000) and cell growth curves were plotted.
Colony formation assays
Colony formation assays as previously described (11). shPRRC2C-BEL-7404, shPRRC2C-SMMC-7721, shCtrl-BEL-7404 and shCtrl-SMMC-7721 Cells (800 cells/well) were seeded in 6-well plates and cultured at 37 ℃ for 2 weeks. After 14 days, cell colonies were fixed with methanol and stained with 0.1% crystal violet (Sigma), and then visible colonies were manually counted under a microscope. The determination was carried out in triplicate.
Wound healing assay
Cells were seeded in 96-well plates at a density of 5×104 cells/well. When the cells formed a tight cell monolayer on the bottom of the plate, a sterilized tip was scraped across the cell monolayer. We washed the cells in PBS three times after remove the cell debris. Then to remove the complete DMEM and add serum-free DMEM into each well. Photomicrographs were taken by an IX71 inverted microscope (Olympus Corporation) at the scratch (0 h) and 24 h later. This assay was repeated 3 times.
Transwell assay
Cells inserts were coated without Matrigel (BD Bioscience). shCotrol-BEL-7404 and shPRRC2C-BEL-7404 cells were seeded a density of 1×105 cells/well in DMEM without serum in the upper chamber. Then, 600 µL DMEM supplemented with 30% FBS was added to the lower chamber. After 16 h of incubation, a cotton swab was used to wipe the non-invasive cells. The invasive cells were fixed with 95% ethanol for 30 min at room temperature and stained with for 40 min at room temperature, followed by cellular count and photograph under a fluorescence microscope (Olympus Corporation, Tokyo, Japan) at a magnification of ×100.
Flow cytometry detected cellular apoptosis
Cells were washed with cold PBS two time and then resuspended at a concentration of 106 cells/mL in 1× 300 µL Binding Buffer (BD Biosciences, USA). Subsequently, the cells were incubated with 5 µL Annexin V-FITC for 10 min followed by 5 µL propidium iodide (PI) at 37 ℃ in darkness for 5 min. They were analyzed by flow cytometry (FACS calibur, BD Biosciences) within 1 h. The percentage of apoptotic cells in samples were determined by estimating the percentage of Annexin V+ PI+ and Annexin V+ PI- cells. This assay was conducted in triplicate.
Xenograft tumor model
5×106 cells in 200 µL DMEM were injected into the right cutaneous armpit of two groups of laboratory mice (4-week-old, female, BALB/c nude mice, 10 in each group, purchased from Shanghai Lingchang Biotechnology Co., LTD). Nude mice were housed in the SPF-grade Experimental Animal Center with a 12:12 light: dark cycle and access to food and water. Each mouse was kept in a cage alone. We measured laboratory mice weight, tumor length and short diameter of tumor after 15 days of injection and collected data 2 times a week for 3 weeks. Lumina LT In Vivo Imaging System (Perkin Elmer, US) was used to regularly visualize total fluorescence in the tumorous regions. All animals were sacrificed at 28 days and the tumors were isolated. The tumor tissue and liver of laboratory mice were collected and fixed in a 10% buffered formaldehyde solution; Tumor growth was monitored at regular intervals by measuring tumor diameter using a caliper. Tumor volume was determined by (length × width2)/2. This research was performed under a project license (No. SUMC2019-355) granted by the Medical Animal Care & Welfare Committee of Shantou University Medical College, in compliance with the Shantou University guidelines for the care and use of animals. A protocol was prepared before the study without registration.
Statistical analysis
Statistical analysis was performed using SPSS 23.0 (IBM, IL, USA) and GraphPad Prism 5 (GraphPad Software, CA, USA) softwares. Differences between two groups were explored using student’s t-test. Non-normally distributed parameters were compared between groups using rank-sum test. Kaplan-Meier analysis for overall survival. Statistical analysis summary data are expressed as the means ± standard deviation (SD). A P value <0.05 was considered significant.
Results
PRRC2C expression was correlated with hepatocarcinoma grades and survival
TCGA data analysis showed that the level of PRRC2 mRNA in liver cancer samples (n=371) was upregulated compared to adjacent normal tissue samples (n=50) (P<0.001, Figure 1A). we observed that a statistically significant increase in PRRC2C expression level was correlated not only with the advanced TNM staging (Figure 1B) and poor pathological grading (Figure 1C). but also, with the shortened overall survival of patients (HR =1.47, 95% CI: 1.02–2.12, P=0.039) (Figure 1D).
Downregulation of PRRC2C inhibits cell proliferation and promote apoptosis of hepatocarcinoma cells
Real-time PCR analysis confirmed that PRRC2C was abundantly expressed in cultured human HCC cell lines (BEL-7402, BEL-7404, SMMC-7721, HepG2) (Figure 1E). We selected BEL-7404 and SMMC-7721 to explored the biological function of PRRC2C. Plasmids vectors containing shRNA sequences targeted to PRRC2C were successfully transfected into BEL-7404 and SMMC-7721 cells, and efficient silencing were 74.0% and 64.6%, respectively (Figure 1F). Further confirmation of a decrease in protein levels (Figure 1G).
Then, BEL-7404 cells were transfected with PRRC2C and negative control shRNA constructs. The results showed that PRRC2C knockdown significantly reduced viable cell number, cell proliferation, and colony formation compared to the negative control group. As shown in Figure 2A-2C. In addition, apoptosis analysis (Figure 2D) proved that PPRC2C knockdown resulted in an increase in the percentage of apoptotic cells (19.94% compared to 1.44% in the control group).
PRRC2C silencing inhibited the migration and invasion capabilities of hepatocarcinoma cells
Using Wound healing assays, we found that the 24-h scratch migration rate in the siPRRC2C group was 18.38%, which was lower than that in the control group (23.13%, P=0.003, Figure 3A). As expected, the number of cells that passed through Matrigel was significantly less in the experimental group than in the control group (only 51% as that of the control group, P<0.05), when detected by Transwell assays (Figure 3B). Both results indicated that knocking down PRRC2C suppressed the cell migration and invasion of liver cancer cells.
PRRC2C regulates the tumorigenesis of liver cancer in vivo
PRRC2C silent expression cells and negative control cells were injected into nude mice and tumor development were detected in a 28-day period. As shown in Figure 4, The result showed that the PRRC2C silent expression group was significantly inhibited growth of tumors. In addition, the numbers of animals bearing detectable tumors at the end of experiments were also lower. Taken together, these results demonstrate that PRRC2C could remarkably inhibit tumorigenicity in liver cancer.
PRRC2C silencing affect expression levels of EMT signaling related genes
To determine whether regulation of liver cancer cell behavior by PRRC2C involves EMT, expressions of EMT-related genes were detected by RT-PCR. The expression of N-cadherin (CDH2) was significantly lower (Figure 5, P<0.05), while Snail, Slug, and Smad3 was higher in the PRRC2C knockdown cells than that in the control group (P<0.05). E-cadherin (CDH1), Twist, and Smad2/4 expression was no significantly different between the two groups (P>0.05). Western blot showed that silencing PRRC2C inhibited the expression of N-cadherin and Vimentin.
Discussion
HCC is a complex disease due to its heterogeneity (12-14). At the molecular level, the pathogenesis of HCC includes genetic, epigenetic, and signaling pathway disorders. Meanwhile, the interaction with the tumor microenvironment leads to the occurrence, progression, and metastasis of tumors. gene amplification as a particularly common mechanism through which the expression levels of genes involved in cancer development can be regulated. Gene amplification is a particularly common mechanism that regulates the increase in the number of gene copies in the genome of cancer cells, resulting in abnormal levels of gene expression in cancer development (15). In this study, PRRC2C was amplify and identified overexpress in established HCC cell lines, including BEL-7402, BEL-7404, SMMC-7721 and Hep G2 cells and this result consistent with previous studies (10,16). It also indicated that PRRC2C was indeed suspicious of its function in generation and development of liver cancer due to its highly expression is associated with tumor progression and poor prognosis in cancer cells.
Therefore, PRRC2C is distinctly ideal biological characteristics of human liver cancer.
Immortal cell proliferation and anti-apoptosis are crucial characteristics of tumors, so tumor-promoting genes generally have anti-apoptosis and pro-proliferation effects. A major finding of this study is that knockdown of PRRC2C could inhibit the proliferation and induce apoptosis of human hepatocarcinoma cell lines while reducing tumorigenicity of HCC cells in nude mice. it indicated that PRRC2C was carcinogenesis. Invasion and metastasis were also important characteristics of tumors. Since the activation of EMT has been implicated in the metastasis of human tumors, we observed that knockdown of PRRC2C profoundly suppressed the invasion of liver cancer cells and the EMT-related gene N-cadherin in this study, but our results did not clarify which pathway through which PRRC2C may regulate E-cadherin, because various transcription factors have been reported to regulate E-cadherin expression. It only suggested that PRRC2C may involve in tumor progression. In addition, EMT process depends on the changes in the expression levels of dozens or even hundreds of genes. The exact mechanism that PRRC2C was involved in this process needs further investigation.
Very few studies have been carried out on PRRC2C leading that the specific molecular mechanism of PRRC2C is still unclear. As a proline-rich protein, its possible mechanism is often taking interaction with other proteins. PRRC2C has been suggested to be associate with stress granules (4) and may be involved in epigenetic regulation of gene expression in stress conditions, while the expression of PRRC2C may be regulated at splicing level. The evidence from a primary non-small cell lung cancer proved that SRSF1 overexpression leaded to abnormal splicing of PRRC2C two alternative spliced products PRRC2C-L (long) and PRRC2C-S (short), then knock down PRRC2C-L and PRRC2C-S reduced proliferation of lung cancer A549 cells (7). These results indicated that the abnormal splicing of PRRC2C was involved in the carcinogenic process and regulated by SRSF1, which belongs to the serine/arginine-rich protein family and is involved in several human tumors (17-19).
Conclusions
The conclusion from this study indicated that PRRC2C promotes the proliferation and metastasis of liver cancer cells and potentially involved in EMT related genes expression.
Acknowledgments
Funding: The study was supported by Shaoguan City Science and Technology Plan Project [grant number 200812114531509]; and Shaoguan City Health Research Project [grant number Y20203].
Footnote
Reporting Checklist: The authors have completed the ARRIVE reporting checklist. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-23-10/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-23-10/dss
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-23-10/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). Animal experiments were performed under a project license (No. SUMC2019-355) granted by the Medical Animal Care & Welfare Committee of Shantou University Medical College, in compliance with the Shantou University guidelines for the care and use of animals.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Bray F, Ferlay J, Soerjomataram I, et al. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2018;68:394-424. [Crossref] [PubMed]
- Siegel R, Naishadham D, Jemal A. Cancer statistics, 2013. CA Cancer J Clin 2013;63:11-30. [Crossref] [PubMed]
- Nie J, Lu L, Du C, et al. FAM83D promotes the proliferation and migration of hepatocellular carcinoma cells by inhibiting the FBXW7/MCL1 pathway. Transl Cancer Res 2022;11:3790-802. [Crossref] [PubMed]
- Youn JY, Dunham WH, Hong SJ, et al. High-Density Proximity Mapping Reveals the Subcellular Organization of mRNA-Associated Granules and Bodies. Mol Cell 2018;69:517-532.e11. [Crossref] [PubMed]
- Kikuno R, Nagase T, Ishikawa K, et al. Prediction of the coding sequences of unidentified human genes. XIV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res 1999;6:197-205. [Crossref] [PubMed]
- Huang WC, Taylor S, Nguyen TB, et al. KIAA1096, a gene on chromosome 1q, is amplified and overexpressed in bladder cancer. DNA Cell Biol 2002;21:707-15. [Crossref] [PubMed]
- de Miguel FJ, Sharma RD, Pajares MJ, et al. Identification of alternative splicing events regulated by the oncogenic factor SRSF1 in lung cancer. Cancer Res 2014;74:1105-15. [Crossref] [PubMed]
- Kaymaz Y, Oduor CI, Yu H, et al. Comprehensive Transcriptome and Mutational Profiling of Endemic Burkitt Lymphoma Reveals EBV Type-Specific Differences. Mol Cancer Res 2017;15:563-76. [Crossref] [PubMed]
- Jacobo-Baca G, Salazar-Ybarra RA, Torres-de-la-Cruz V, et al. Proteomic profile of preeclampsia in the first trimester of pregnancy. J Matern Fetal Neonatal Med 2022;35:3446-52. [Crossref] [PubMed]
- Kim HE, Kim DG, Lee KJ, et al. Frequent amplification of CENPF, GMNN and CDK13 genes in hepatocellular carcinomas. PLoS One 2012;7:e43223. [Crossref] [PubMed]
- Sang Y, Chen B, Song X, et al. circRNA_0025202 Regulates Tamoxifen Sensitivity and Tumor Progression via Regulating the miR-182-5p/FOXO3a Axis in Breast Cancer. Mol Ther 2019;27:1638-52. [Crossref] [PubMed]
- Ferlay J, Soerjomataram I, Dikshit R, et al. Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer 2015;136:E359-86. [Crossref] [PubMed]
- Khalaf N, Ying J, Mittal S, et al. Natural History of Untreated Hepatocellular Carcinoma in a US Cohort and the Role of Cancer Surveillance. Clin Gastroenterol Hepatol 2017;15:273-281.e1. [Crossref] [PubMed]
- Dhanasekaran R, Bandoh S, Roberts LR. Molecular pathogenesis of hepatocellular carcinoma and impact of therapeutic advances. F1000Res 2016;5:F1000 Faculty Rev-879.
- Medina PP, Castillo SD, Blanco S, et al. The SRY-HMG box gene, SOX4, is a target of gene a3plification at chromosome 6p in lung cancer. Hum Mol Genet 2009;18:1343-52. [Crossref] [PubMed]
- Nong YX, Huang JL, Huang ZS, et al. Characteristics and experimental applications of human hepatocellular carcinoma cell lines. World Chinese Journal of Digestology 2017;25:159.
- Long JC, Caceres JF. The SR protein family of splicing factors: master regulators of gene expression. Biochem J 2009;417:15-27. [Crossref] [PubMed]
- Shen S, Warzecha CC, Carstens RP, et al. MADS+: discovery of differential splicing events from Affymetrix exon junction array data. Bioinformatics 2010;26:268-9. [Crossref] [PubMed]
- Kechris K, Yang YH, Yeh RF. Prediction of alternatively skipped exons and splicing enhancers from exon junction arrays. BMC Genomics 2008;9:551. [Crossref] [PubMed]

