The role of TMSB15A in gastric cancer progression and its prognostic significance
Highlight box
Key findings
• Human thymosin β15 (TMSB15A) expression was significantly elevated in gastric cancer (GC) tissues and correlated with a worse prognosis.
• TMSB15A demonstrated diagnostic value for GC and high accuracy (area under the curve =0.851; 95% confidence interval: 0.786–0.905; P<0.05).
• Gene set enrichment analysis (GSEA) indicated that TMSB15A was linked to the interleukin-6 (IL-6)/Janus kinase (JAK)/signal transducer and activator of transcription 3 (STAT3) and transforming growth factor β (TGF-β) signaling pathways, suggesting its involvement in GC progression.
• In vitro studies confirmed that increased TMSB15A expression enhanced GC tumorigenesis and metastasis.
What is known and what is new?
• TMSB15A is recognized for its protumorigenic role in various malignancies, but its role in GC remains unclear.
• This study establishes TMSB15A as a critical contributor to GC progression, providing diagnostic, prognostic, and therapeutic insights.
What is the implication, and what should change now?
• TMSB15A is a potential therapeutic target for GC management, and clinical strategies that inhibit its activity should be further investigated.
• Future research should focus on developing targeted interventions to modulate TMSB15A expression and is associated pathways to improve patient outcomes.
Introduction
Gastric cancer (GC) is a prevalent gastrointestinal malignancy that is highly aggressive and heterogeneous, representing a significant global health concern. In 2020, GC ranked fifth and fourth globally in terms of cancer diagnosis and associated mortality, respectively, with roughly 1.1 million new diagnoses and 800,000 deaths. In China, GC ranks third in both cancer diagnoses and deaths, accounting for approximately 510,000 diagnoses and 400,000 deaths annually (1,2). Several risk factors have been associated with the onset of GC, including Helicobacter pylori infection (3), family history (4), alcohol consumption (5), smoking (6), and infection with Epstein-Barr virus (EBV) (7). The aging of the population will cause a rise in the number of GC cases encountered in clinical practice. It is unfortunate that early GC is ill-defined clinically, that the diagnosis rates are low, and that GC is typically confirmed pathologically in the advanced stages (8). Despite major breakthroughs in various treatment modalities, the clinical outlook of patients with GC remains uncertain. The median survival is around 10 months, with the 5-year survival rates being below 20% (9,10). Therefore, identifying biomarkers relevant to the growth and metastasis of GC will facilitate the improvement of prognoses and survival rates among patients with GC.
Beta-thymosin is a subfamily of thymosin consisting of highly conserved acidic proteins, primarily thymosin β4 (TMSB4), thymosin β10 (TMSB10), and thymosin β15 (TMSB15). Among these, TMSB15 is the least studied family member, and the literature on this subject is sparse (11). Thymosin functions as an actin-chelating protein, regulating the cytoskeletal-microfilament system and influencing cell motility, which is essential for a number of cellular processes, including mitosis, intracellular phagocytosis, and metastasis (12-14). Cell motility is a fundamental process that underlies numerous stages of the metastatic cascade, including tumor angiogenesis, invasion, and metastasis. Aberrant cell migration also plays a significant role in tumor progression (15). The latest research has emphasized the link between the β-thymosin family and various cancers. TMSB4 has demonstrated oncogenic functions in several tumors, such as colorectal and breast cancer (16,17), while TMSB10 is overexpressed in breast cancer, papillary thyroid carcinoma, and hepatocellular carcinoma, in which it is associated with tumor progression (18-20). Similar to TMSB4 and TMSB10, TMSB15A is also upregulated in cancer cell lines of various origins, including prostate (21), breast (22,23), glioma (24), hepatocellular carcinoma (25), and head and neck cancer (26), and is associated with tumor cell migration. However, the function of TMSB15A in GC remains unknown.
This study primarily aims to explore the role of TMSB15A in GC progression, and to evaluate its diagnostic and prognostic significance. We hypothesize that elevated TMSB15A expression in GC tissues is associated with poor prognosis and could serve as a valuable diagnostic and prognostic biomarker. We conducted this study, which is one of the first to use bioinformatics to examine the function of TMSB15A in GC. Significant associations were found between elevated TMSB15A expression in GC and a variety of clinicopathological characteristics, and TMSB15A indicated a poor prognosis. TMSB15A was identified as a potential diagnostic biomarker for GC through receiver operating characteristic (ROC) curve analyses. Furthermore, TMSB15A was verified as an indicator of GC by both univariate and multivariate Cox regression. Subsequently, gene set enrichment analysis (GSEA) confirmed the relevant pathways regulated by TMSB15A. Subsequently, functional experiments demonstrated that TMSB15A is capable of regulating tumorigenic behavior in GC cells. The findings attest to the role of TMSB15A in GC development, suggesting its potential as a biomarker for GC.
Overall, our results suggest that TMSB15A is closely related to GC tumorigenesis, and increased expression levels were associated with poor clinical results, supporting TMSB15A as a diagnostic and predictive biomarker for GC. Our findings may help to lay a novel biological foundation for future GC treatment and management strategies. We present this article in accordance with the MDAR reporting checklist (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-64/rc).
Methods
Ethical approval and patient cohort
Tissue samples were obtained from patients with GC from the Department of General Surgery, Nantong Tumor Hospital, between 2018 and 2022. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013) and approved by the Ethics Committee of Nantong Tumor Hospital (No. 2020-033). Written informed consent was obtained from the patients. A total of 58 GC patients undergoing curative resection were recruited, with matched tumor and adjacent normal tissues snap-frozen in liquid nitrogen. Clinicopathological characteristics are summarized in Table 1.
Table 1
| Clinicopathological parameter | N | TMSB15A expression | P value | |
|---|---|---|---|---|
| Low (n=29) | High (n=29) | |||
| Gender | 0.24 | |||
| Male | 16 | 10 | 6 | |
| Female | 42 | 19 | 23 | |
| Age (years) | 0.56 | |||
| ≤65 | 16 | 9 | 7 | |
| >65 | 42 | 20 | 22 | |
| Degree of differentiation | 0.07 | |||
| Well | 7 | 4 | 3 | |
| Moderate/poor | 51 | 25 | 26 | |
| Tumor diameter (cm) | 0.08 | |||
| <5 | 42 | 24 | 18 | |
| ≥5 | 16 | 5 | 11 | |
| Tumor localization | 0.79 | |||
| Up | 27 | 13 | 14 | |
| Middle/down | 31 | 16 | 15 | |
| TNM stage | 0.009* | |||
| I + II | 30 | 20 | 10 | |
| III | 28 | 9 | 19 | |
| Depth of invasion | 0.04* | |||
| T1 + T2 | 28 | 18 | 10 | |
| T3 + T4 | 30 | 11 | 19 | |
| Lymph node metastasis | 0.003* | |||
| Negative | 23 | 17 | 6 | |
| Positive | 35 | 12 | 23 | |
| Perineural invasion | 0.02* | |||
| Negative | 35 | 22 | 13 | |
| Positive | 23 | 7 | 16 | |
*, P<0.05. GC, gastric cancer; T, tumor invading the submucosa; TNM, tumor, node, metastasis.
Data collection and analysis
The expression and clinical data for 36 noncancerous gastric tissues and 412 GC tissues were acquired from The Cancer Genome Atlas (TCGA) dataset (https://tcga-data.nci.nih.gov/tcga/). The R programming language (The R Foundation for Statistical Computing) was used to standardize data, preprocess, and apply logarithmic transformations. Genes with differential expression were identified using the following criteria: a false discovery rate (FDR) <0.05 and a log2 fold change (FC) of at least 1.
ROC curve and logistic regression analysis
Following the collection of patient prognostic data and TMSB15A expression levels, ROC curves were used for analysis, which was integrated with time-dependent ROC evaluations (27). Sensitivity, or the true positive rate, is represented on the y-axis of the curve and indicates the proportion of correctly identified positive instances. Specificity, or the true negative rate, is calculated as 1 − false positive rate (FPR), where the FPR is plotted on the x-axis. The area under the curve (AUC) values obtained were employed to assess the diagnostic and prognostic value of TMSB15A in GC. Logistic regression was used to assess the associations between TMSB15A levels and several clinical factors, including patient age, sex, and pathological stage, as well as T, N, and M classifications. A P value <0.05 was considered to indicate significance in accordance with established standards (28).
Cox hazard regression analysis
Univariate and multivariate Cox regression was used to identify factors independently predictive of patient overall survival (OS) (29). The variables examined included TMSB15A levels and pathological, T, N, and M stages.
Kyoto Encyclopedia of Genes and Genomes (KEGG) and GSEA
The GSEA was conducted using the R programming language (version 4.2.0) and the “clusterProfiler” package, as described previously (30,31). Data for the analysis were obtained from the KEGG database.
Cell culture
GC cell lines (AGS, MKN-45, SGC7901, and HGC-27) and the control GES-1 gastric mucosal line were acquired from GeneChem (Shanghai, China). All cell lines were incubated at 37 ℃ in RPMI-1640 with 10% fetal bovine serum (FBS) in a 5% CO2 atmosphere
Cell transfection and quantitative real-time polymerase chain reaction (qRT-PCR)
Cells were inoculated in six-well plates and transfected with Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific, Waltham, MA, USA) and TMSB15A-specific short hairpin RNA (shRNA) or control constructs from RiboBio (Guangzhou, China). Following a 48-hour incubation period, the cells were prepared for subsequent assays. qRT-PCR performed according to standard methods was used to measure TMSB15A levels through use of the total RNA extracted from tissues and TRIzol (Invitrogen). Primers for gene amplification included TMSB15A (forward: GGTGCATATGTTCCAGATGGC; reverse: GCAATGGAAGCACCCATCAT) and GAPDH (forward: 5'-TGCACCACAACTGCTTAGC-3'; reverse: 5'-GGCATGGACTGTGGTCATGAG-3').
Cell migration assay
Cells (5×104/100 µL) in serum-free RPMI 1640 were introduced to the upper compartment of a Transwell insert (8-mm pore size, Corning, Corning, NY, USA) in 24-well plates for examining cell migration. Medium (600 µL) with 10% FBS was placed in the lower compartment. After 24-hour growth at 37 ℃ in a 5% CO2 atmosphere, cells adhering to the membrane were removed, and the filter was fixed in methanol at room temperature. The migrated cells in eight fields were enumerated under light microscopy. This experiment was performed in triplicate (32).
5-ethynyl-2'-deoxyuridine (EdU) and colony formation assays
The EdU incorporation assay was used to measure cell proliferation. Briefly, GC cell lines were seeded in 6-well plates and cultured to approximately 70–80% confluence. Cells were then incubated with EdU (10 µM) for 2 hours at 37 ℃. After incubation, cells were fixed with 4% paraformaldehyde, and EdU detection was performed using the BeyoClick™ EdU-488 Cell Proliferation Detection Kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s protocol. The proliferative index was calculated by counting the number of EdU-positive cells under a fluorescence microscope. For the colony formation assay, GC cells were seeded in 6-well plates at low density (500 cells/well) and cultured for 10–14 days. The medium was refreshed every 3 days. After the incubation period, colonies were fixed with 4% paraformaldehyde and stained with crystal violet (0.5% in methanol). Colonies consisting of more than 50 cells were counted using a low-power microscope. The colony formation efficiency was calculated by dividing the number of colonies formed by the number of seeded cells (33).
Statistical analysis
The results of three experiments are shown as the mean ± standard deviation (SD). Data were analyzed with GraphPad Prism 7.0 (GraphPad Software, Dotmatics, Boston, MA, USA), SPSS 22.0 (IBM Corp., Armonk, NY, USA), and R version 4.1.2. P values <0.05 were considered statistically significant.
Results
TMSB15A levels were elevated in GC and correlated with poor prognosis
Our investigation of TCGA database showed that TMSB15A levels were markedly elevated in GC tissues (Figure 1A,1B). Upon analyzing paired GC samples, we noted that TMSB15A levels in GC tissues were significantly elevated compared to those in normal tissues (Figure 1C). Diagnostic ROC curve analysis showed that TMSB15A had good diagnostic capability, with an AUC value of 0.851 (Figure 1D). This high AUC indicates strong diagnostic potential for TMSB15A in distinguishing between GC and normal tissues. Furthermore, time-dependent ROC curve analysis revealed that TMSB15A exhibited strong predictive capabilities for GC, with AUCs of 0.626, 0.642, and 0.658 at 1, 3, and 5 years, respectively (Figure 1E). Kaplan-Meier curves indicated an association between increased TMSB15A expression and reduced OS, disease-specific survival (DSS), progression-free interval (PFI), and disease-free interval (DFI) in patients with GC (Figure 2). In conclusion, TMSB15A demonstrated capability as a biomarker for early GC diagnosis and was significantly linked to poor patient prognosis.
Association of TMSB15A levels with the clinicopathological parameters of patients with GC
Based on our analysis of TCGA database, we found that TMSB15A expression in patients with GC were not linked with pathological stage, age, gender, or N stage. Meanwhile, we found that with more advanced T stage, TMSB15A expression increased. It is also worth noting that TMSB15A levels were elevated in patients with M1 disease relative to those with M0 disease (Figure 3A-3F). In summary, TMSB15A expression appears to be associated with the development and metastasis of GC, and our findings may provide insights into the function of TMSB15A in tumorigenesis and into its value as a marker for assessing the pathological characteristics of GC.
TMSB15A as an independent predictive factor of GC
Univariate Cox regression identified the significant predictors for the prognosis of patients with GC to be T, N, and M stages; overall staging; and TMSB15A expression (Figure 4A). This was verified by further multivariate Cox regression analysis (Figure 4B). The independent predictive capability of TMSB15A for the prognosis of patients with GC supports its use as a novel biomarker that can be used to design personalized therapies and improve prognostic evaluations.
GSEA
The findings of the GSEA indicated that TMSB15A expression was linked with a variety of pathways, including the interleukin-6 (IL-6)/Janus kinase (JAK)/signal transducer and activator of transcription 3 (STAT3), transforming growth factor β (TGF-β), Hedgehog, Notch, and TNF-α and the IL-2/STAT5 pathways, among others (Figure 5A-5F). Previous studies have shown that these pathways promote the development of GC, so we speculated that TMSB15A may regulate the progression of GC through these pathways. Overall, GSEA revealed the signaling pathways involved in TMSB15A, reinforced its important regulatory role in GC development, and provided strong theoretical support for further research on its therapeutic targets.
Association TMSB15A expression in clinical tissues and clinicopathologic features
To confirm our findings, we examined 58 pairs of GC tissues and noted a significant elevation in TMSB15A expression, as determined by qRT-PCR analysis (Figure 6A). Logistic regression analysis indicated significant correlations between TMSB15A levels and numerous pathological characteristics, for instance, infiltration depth (P=0.04), lymph node metastasis (P=0.003), TNM stage (P=0.009), and perineural infiltration (P=0.02) (Table 1). These findings indicate that TMSB15A level is correlated with GC pathology. Our analysis of clinical tissue samples demonstrated that TMSB15A is involved in the progression of GC and could function as an ideal therapeutic target and a clinical prognostic marker in future research.
TMSB15A promoted tumorigenic behavior in GC cells
To verify the bioinformatics predictions, we performed cell experiments. qRT-PCR measurements of the GES-1 and GC cell lines (HGC-27, MKN-45, SGC-7901, and BGC-823) showed that TMSB15A levels were higher in GC cells relative to those of GES-1. In particular, TMSB15A levels were higher in HGC-27 and MKN-45 cells (Figure 6B). Next, we performed TMSB15A knockdown in HGC-27 and MKN-45 cells and evaluated the knockdown efficiency via qRT-PCR (Figure 6C,6D). Clone formation assays showed that TMSB15A knockdown inhibited cell proliferation (Figure 6E), which was confirmed by EdU assays (Figure 6F). Transwell assays were used to confirm the effect of TMSB15A on GC cell migration and invasion, with TMSB15A knockdown reducing both migration and invasion (Figure 6G). In summary, as confirmed by in vitro experiments, TMSB15A regulates the proliferation, migration, and invasion in GC cells, suggesting its role in regulating GC development and progression. This finding may provide the experimental basis for the further in-depth study of applying TMSB15A to GC treatment.
Discussion
Despite the extraordinary progress made in the diagnosis and treatment of GC over the past decades, there remains a lack of reliable and sensitive early diagnostic techniques, which has resulted in GC being pathologically confirmed often at an advanced stage (34). A study has shown that in advanced stages of cancer development, certain cancer cells lose epithelial markers while acquiring mesenchymal cell properties that confer stem cell characteristics and promote the invasion of surrounding tissues, infiltration of the circulation, and ultimately proliferation and growth in new organs or tissues—otherwise known as the metastatic process (10). The treatment of metastatic tumors primarily involves palliative care, and metastasis is not considered completely curable and constitutes the main cause of cancer death.
The role played by a subset of genes in GC development has been elucidated; for example, HER2 has been well-documented as a tumor-promoting molecule in GC that promotes GC onset and progression by regulating cell proliferation, migration, and infiltration (35). CHSY3 is another GC tumor-promoting agent that has been linked with reduced survival in GC (36). The unregulated expression and activation of Nrf2 have been noted in GC cells, correlating with a poor prognosis for patients with GC (34). However, the mechanisms underlying the development and metastasis of GC have not been clarified and involve a complex interaction of numerous genes and signaling pathways. Therefore, ongoing research on key molecules that influence the development and progression of GC is crucial for improving patient prognosis.
Thymosin β is an important peptide secreted by thymic epithelial cells (TECs), which plays a critical role in regulating cellular growth, development, and T-lymphocyte function, primarily through paracrine and autocrine mechanisms (37,38). It has been reported that Helicobacter pylori is involved in the process of gastric ulcer formation by inducing regulatory T-cell responses. In GC, increased infiltration of CD3+ and CD8+ T lymphocytes predicts a better prognosis (39,40). In addition, β-thymosin is closely associated with myocardial repair, insulin secretion, and other aspects of physiological function (41,42). Recently, β-thymosin has been linked with tumor onset and progression. For instance, TMSB4 functions as an oncogene in various tumors such as malignant melanoma, oral cavity cancer, and cholangiocarcinoma (43,44). β-thymosin is upregulated in renal clear-cell carcinoma, bladder carcinoma, gastric carcinoma, breast cancer, and hepatocellular carcinoma, and overexpression of TMSB10 predicts poor outcome and promotes cancer progression (45,46). TMSB15, the thymosin with the highest affinity for actin, affects actin remodeling by regulating the intracellular G-actin: F-actin ratio, which ultimately influences cell motility and angiogenesis (47). We thus hypothesized that TMSB15A may be involved in tumorigenesis. Indeed, it is significantly expressed in various cancers and linked with the migration of tumor cells. One study found TMSB15A expression to be upregulated in triple-negative breast cancer with increased cell motility, as evidenced by higher expression levels in highly invasive and poorly differentiated cancers (22). In addition, TMSB15 expression was found to affect the migratory ability of non-small cell cancer cells and to correlate with cancer progression and metastasis, and similar results were reported for prostate cancer (48). However, while these findings are promising, further studies are needed to validate the functional role of TMSB15A in GC.
Data on TMSB15A expression and clinical parameters were obtained from the stomach adenocarcinoma (STAD) dataset in TCGA (TCGA-STAD). A comprehensive analysis showed that TMSB15A levels were markedly higher in GC tissues than in normal tissues. In addition to the TCGA dataset, we also analyzed 58 paired samples of GC and normal tissues from our hospital using qRT-PCR, which confirmed the upregulation of TMSB15A in GC tissues. Kaplan-Meier curves indicated a link between elevated TMSB15A expression and lower OS, DSS, and PFI. According to the time-dependent ROC analysis, the AUCs for the 1-, 3-, and 5-year OS rates were 0.626, 0.642, and 0.658, respectively. Therefore, we concluded that TMSB15A was predictive of unfavorable GC prognosis and was also correlated with T and M stages in GC. Both univariate and multivariate Cox regression analyses with TCGA data indicated that TMSB15A was independently predictive of GC prognosis. Importantly, the inclusion of clinical patient samples further strengthens these findings and highlights the potential clinical relevance of TMSB15A as a biomarker for GC. However, while we have confirmed the oncogenic role of TMSB15A through in vitro assays, it is important to note that the lack of in vivo validation remains a limitation. Future studies should incorporate animal models to perform in vivo tumorigenicity assays, which will help confirm the role of TMSB15A in GC progression and metastasis. This will provide a more comprehensive understanding of its functional significance in a living organism and further solidify its potential as a therapeutic target.
In line with previous findings, we found through GSEA that TMSB15A is involved in a variety of tumor-related pathways including IL-6/JAK/STAT3 (49), TGF-β (50), Hedgehog (51), Notch (52), TNF via NF-κB (53), and IL-2/STAT5 (54). Subsequent cell EdU assays showed that knockdown of TMSB15A inhibited GC cell proliferation, while Transwell assays confirmed that TMSB15A regulated the migratory and invasive abilities of GC cells. ROC curves were also used to determine TMSB15A’s diagnostic potential in GC. The AUC was 0.851, indicating that it could be used as a diagnostic biomarker. These findings demonstrate that TMSB15A is involved in GC tumorigenesis and that higher levels are predictive of unfavorable prognosis.
However, the mechanistic basis of how TMSB15A regulates these key oncogenic pathways remains unclear. Although we have provided evidence for its association with these pathways, future research is needed to perform functional validation of the molecular mechanisms. Specifically, gene knockdown or overexpression studies, combined with pathway inhibitors, could help elucidate how TMSB15A modulates these critical pathways in GC progression. Moreover, further investigations into the molecular interactions and downstream effects of TMSB15A in specific signaling pathways will provide deeper insights into its role as a regulator of GC tumorigenesis.
Additionally, we acknowledge that the prognostic validation using the 58 clinical patient samples is still in progress, and the data will be included in future studies. We also recognize that potential confounders such as tumor heterogeneity, treatment history, and other clinicopathological variables might influence the interpretation of TMSB15A expression levels. Due to the cross-sectional nature of our study and the lack of detailed treatment history data, these factors were not fully assessed. Future studies should carefully control these variables by incorporating comprehensive clinical data to clarify the role of TMSB15A in GC progression.
We propose that future research should explore potential inhibitors or therapeutic strategies targeting TMSB15A to enhance treatment outcomes for GC patients.
Conclusions
Our study’s findings showed that TMSB15A may function as a significant biomarker for the early diagnosis, prognosis, and treatment of patients with GC. The results indicate that elevated expression levels of TMSB15A may facilitate tumor development and predict poor prognosis for patients with GC. Furthermore, several signaling pathways were associated with TMSB15A, including the IL-6/JAK/STAT3, TGF-β, Hedgehog, Notch, TNF-α (via NF-κB), and IL-2/STAT5 pathways.
Acknowledgments
None.
Footnote
Reporting Checklist: The authors have completed the MDAR reporting checklist. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-64/rc
Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-64/dss
Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-64/prf
Funding: None.
Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-64/coif). The authors have no conflicts of interest to declare.
Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013) and approved by the Ethics Committee of Nantong Tumor Hospital (No. 2020-033), and written informed consent was obtained from the patients.
Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.
References
- Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
- Ji YT, Liu SW, Zhang YM, et al. Comparison of the latest cancer statistics, cancer epidemic trends and determinants between China and the United States. Zhonghua Zhong Liu Za Zhi 2024;46:646-56. [PubMed]
- Zavros Y, Merchant JL. The immune microenvironment in gastric adenocarcinoma. Nat Rev Gastroenterol Hepatol 2022;19:451-67. [Crossref] [PubMed]
- Zhou J, Sun K, Wang S, et al. Associations between cancer family history and esophageal cancer and precancerous lesions in high-risk areas of China. Chin Med J (Engl) 2022;135:813-9. [Crossref] [PubMed]
- Lee HW, Huang D, Shin WK, et al. Frequent low dose alcohol intake increases gastric cancer risk: the Health Examinees-Gem (HEXA-G) study. Cancer Biol Med 2022;19:1224-34. [Crossref] [PubMed]
- Martini K. Tobacco-associated cancer: More than just lung cancer. Radiologie (Heidelb) 2022;62:758-62. [Crossref] [PubMed]
- Shechter O, Sausen DG, Gallo ES, et al. Epstein-Barr Virus (EBV) Epithelial Associated Malignancies: Exploring Pathologies and Current Treatments. Int J Mol Sci 2022;23:14389. [Crossref] [PubMed]
- Smyth EC, Nilsson M, Grabsch HI, et al. Gastric cancer. Lancet 2020;396:635-48. [Crossref] [PubMed]
- Fukagawa T, Katai H, Mizusawa J, et al. A prospective multi-institutional validity study to evaluate the accuracy of clinical diagnosis of pathological stage III gastric cancer (JCOG1302A). Gastric Cancer 2018;21:68-73. [Crossref] [PubMed]
- Joshi SS, Badgwell BD. Current treatment and recent progress in gastric cancer. CA Cancer J Clin 2021;71:264-79. [Crossref] [PubMed]
- Safer D, Golla R, Nachmias VT. Isolation of a 5-kilodalton actin-sequestering peptide from human blood platelets. Proc Natl Acad Sci U S A 1990;87:2536-40. [Crossref] [PubMed]
- Bao L, Loda M, Zetter BR. Thymosin beta15 expression in tumor cell lines with varying metastatic potential. Clin Exp Metastasis 1998;16:227-33. [Crossref] [PubMed]
- Anadón R, Rodríguez Moldes I, Carpintero P, et al. Differential expression of thymosins beta(4) and beta(10) during rat cerebellum postnatal development. Brain Res 2001;894:255-65. [Crossref] [PubMed]
- Low TL, Hu SK, Goldstein AL. Complete amino acid sequence of bovine thymosin beta 4: a thymic hormone that induces terminal deoxynucleotidyl transferase activity in thymocyte populations. Proc Natl Acad Sci U S A 1981;78:1162-6. [Crossref] [PubMed]
- Sribenja S, Wongkham S, Wongkham C, et al. Roles and mechanisms of β-thymosins in cell migration and cancer metastasis: an update. Cancer Invest 2013;31:103-10. [Crossref] [PubMed]
- Kuo CY, Jhuang JY, Huang WC, et al. Aberrant Expression of Thymosin Beta-4 Correlates With Advanced Disease and BRAF V600E Mutation in Thyroid Cancer. J Histochem Cytochem 2022;70:707-16. [Crossref] [PubMed]
- Adami GR, O'Callaghan TN, Kolokythas A, et al. A loss of profilin-1 in late-stage oral squamous cell carcinoma. J Oral Pathol Med 2017;46:489-95. [Crossref] [PubMed]
- Zhang X, Ren D, Guo L, et al. Thymosin beta 10 is a key regulator of tumorigenesis and metastasis and a novel serum marker in breast cancer. Breast Cancer Res 2017;19:15. [Crossref] [PubMed]
- Zeng J, Yang X, Yang L, et al. Thymosin β10 promotes tumor-associated macrophages M2 conversion and proliferation via the PI3K/Akt pathway in lung adenocarcinoma. Respir Res 2020;21:328. [Crossref] [PubMed]
- Wang C, Ma X, Zhang J, et al. DNMT1 maintains the methylation of miR-152-3p to regulate TMSB10 expression, thereby affecting the biological characteristics of colorectal cancer cells. IUBMB Life 2020;72:2432-43. [Crossref] [PubMed]
- Chakravatri A, Zehr EM, Zietman AL, et al. Thymosin beta-15 predicts for distant failure in patients with clinically localized prostate cancer-results from a pilot study. Urology 2000;55:635-8. [Crossref] [PubMed]
- Wang Y, Klijn JG, Zhang Y, et al. Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet 2005;365:671-9. [Crossref] [PubMed]
- Darb-Esfahani S, Kronenwett R, von Minckwitz G, et al. Thymosin beta 15A (TMSB15A) is a predictor of chemotherapy response in triple-negative breast cancer. Br J Cancer 2012;107:1892-900. [Crossref] [PubMed]
- Shai R, Shi T, Kremen TJ, et al. Gene expression profiling identifies molecular subtypes of gliomas. Oncogene 2003;22:4918-23. [Crossref] [PubMed]
- Wang XK, Zhang XD, Luo K, et al. Comprehensive analysis of candidate signatures of long non-coding RNA LINC01116 and related protein-coding genes in patients with hepatocellular carcinoma. BMC Gastroenterol 2023;23:216. [Crossref] [PubMed]
- Yanan L, Hui L, Zhuo C, et al. Comprehensive analysis of mitophagy in HPV-related head and neck squamous cell carcinoma. Sci Rep 2023;13:7480. [Crossref] [PubMed]
- Obuchowski NA, Bullen JA. Receiver operating characteristic (ROC) curves: review of methods with applications in diagnostic medicine. Phys Med Biol 2018;63:07TR01. [Crossref] [PubMed]
- Huang X, Cao Y, Bao P, et al. High expression of PI4K2A predicted poor prognosis of colon adenocarcinoma (COAD) and correlated with immunity. Cancer Med 2023;12:837-51. [Crossref] [PubMed]
- Chen Y, Li ZY, Zhou GQ, et al. An Immune-Related Gene Prognostic Index for Head and Neck Squamous Cell Carcinoma. Clin Cancer Res 2021;27:330-41. [Crossref] [PubMed]
- Yu G, Wang LG, Han Y, et al. clusterProfiler: an R package for comparing biological themes among gene clusters. OMICS 2012;16:284-7. [Crossref] [PubMed]
- Wu T, Hu E, Xu S, et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation (Camb) 2021;2:100141. [Crossref] [PubMed]
- Ma S, Gu X, Shen L, et al. CircHAS2 promotes the proliferation, migration, and invasion of gastric cancer cells by regulating PPM1E mediated by hsa-miR-944. Cell Death Dis 2021;12:863. [Crossref] [PubMed]
- Huang X, Liu Y, Qian C, et al. CHSY3 promotes proliferation and migration in gastric cancer and is associated with immune infiltration. J Transl Med 2023;21:474. [Crossref] [PubMed]
- Vergara D, Stanca E, Guerra F, et al. β-Catenin Knockdown Affects Mitochondrial Biogenesis and Lipid Metabolism in Breast Cancer Cells. Front Physiol 2017;8:544. [Crossref] [PubMed]
- Gao Z, Song C, Li G, et al. Pyrotinib treatment on HER2-positive gastric cancer cells promotes the released exosomes to enhance endothelial cell progression, which can be counteracted by apatinib. Onco Targets Ther 2019;12:2777-87. [Crossref] [PubMed]
- Farkhondeh T, Pourbagher-Shahri AM, Azimi-Nezhad M, et al. Roles of Nrf2 in Gastric Cancer: Targeting for Therapeutic Strategies. Molecules 2021;26:3157. [Crossref] [PubMed]
- Maar K, Hetenyi R, Maar S, et al. Utilizing Developmentally Essential Secreted Peptides Such as Thymosin Beta-4 to Remind the Adult Organs of Their Embryonic State-New Directions in Anti-Aging Regenerative Therapies. Cells 2021;10:1343. [Crossref] [PubMed]
- Xu X, He K, Hoffman RD, et al. Thymosin Beta 15 Alters the Spatial Development of Thymic Epithelial Cells. Cells 2022;11:3679. [Crossref] [PubMed]
- Robinson K, Kenefeck R, Pidgeon EL, et al. Helicobacter pylori-induced peptic ulcer disease is associated with inadequate regulatory T cell responses. Gut 2008;57:1375-85. [Crossref] [PubMed]
- Mansuri N, Birkman EM, Heuser VD, et al. Association of tumor-infiltrating T lymphocytes with intestinal-type gastric cancer molecular subtypes and outcome. Virchows Arch 2021;478:707-17. [Crossref] [PubMed]
- Li Q, Zhang Q, Kim YR, et al. Deficiency of endothelial sirtuin1 in mice stimulates skeletal muscle insulin sensitivity by modifying the secretome. Nat Commun 2023;14:5595. [Crossref] [PubMed]
- Gladka MM, Kohela A, Molenaar B, et al. Cardiomyocytes stimulate angiogenesis after ischemic injury in a ZEB2-dependent manner. Nat Commun 2021;12:84. [Crossref] [PubMed]
- Makowiecka A, Malek N, Mazurkiewicz E, et al. Thymosin β4 Regulates Focal Adhesion Formation in Human Melanoma Cells and Affects Their Migration and Invasion. Front Cell Dev Biol 2019;7:304. [Crossref] [PubMed]
- Kraiklang R, Pairojkul C, Khuntikeo N, et al. A novel predictive equation for potential diagnosis of cholangiocarcinoma. PLoS One 2014;9:e89337. [Crossref] [PubMed]
- Pan Q, Cheng G, Liu Y, et al. TMSB10 acts as a biomarker and promotes progression of clear cell renal cell carcinoma. Int J Oncol 2020;56:1101-14. [Crossref] [PubMed]
- Yan Z, Yan Q, Song Y, et al. TMSB10, a potential prognosis prediction biomarker, promotes the invasion and angiogenesis of gastric cancer. J Gastroenterol Hepatol 2021;36:3102-12. [Crossref] [PubMed]
- Banyard J, Barrows C, Zetter BR. Differential regulation of human thymosin beta 15 isoforms by transforming growth factor beta 1. Genes Chromosomes Cancer 2009;48:502-9. [Crossref] [PubMed]
- Hutchinson LM, Chang EL, Becker CM, et al. Use of thymosin beta15 as a urinary biomarker in human prostate cancer. Prostate 2005;64:116-27. [Crossref] [PubMed]
- Liu M, Li H, Zhang H, et al. RBMS1 promotes gastric cancer metastasis through autocrine IL-6/JAK2/STAT3 signaling. Cell Death Dis 2022;13:287. [Crossref] [PubMed]
- Juarez I, Gutierrez A, Vaquero-Yuste C, et al. TGFB1 polymorphisms and TGF-β1 plasma levels identify gastric adenocarcinoma patients with lower survival rate and disseminated disease. J Cell Mol Med 2021;25:774-83. [Crossref] [PubMed]
- Xu X, Li Y, Liu G, et al. MiR-378a-3p acts as a tumor suppressor in gastric cancer via directly targeting RAB31 and inhibiting the Hedgehog pathway proteins GLI1/2. Cancer Biol Med 2022;19:1662-82. [Crossref] [PubMed]
- Hui Y, Wenguang Y, Wei S, et al. circSLC4A7 accelerates stemness and progression of gastric cancer by interacting with HSP90 to activate NOTCH1 signaling pathway. Cell Death Dis 2023;14:452. [Crossref] [PubMed]
- Low JT, Christie M, Ernst M, et al. Loss of NFKB1 Results in Expression of Tumor Necrosis Factor and Activation of Signal Transducer and Activator of Transcription 1 to Promote Gastric Tumorigenesis in Mice. Gastroenterology 2020;159:1444-1458.e15. [Crossref] [PubMed]
- Wang M, Chen L, Chen Y, et al. Intracellular matrix Gla protein promotes tumor progression by activating JAK2/STAT5 signaling in gastric cancer. Mol Oncol 2020;14:1045-58. [Crossref] [PubMed]

