The long noncoding RNA RMRP-miR-3135a-SV2A axis promotes the development of hepatocellular carcinoma

Introduction

Liver cancer is the sixth most common malignancy worldwide and ranks third as a cause of cancer-related death (1,2). Hepatocellular carcinoma (HCC) is the most common subtype of primary liver cancer, accounting for approximately 75–85% of all patients with liver cancer (3). In 2020, there were 900,000 new cases of HCC and 830,000 HCC-related deaths worldwide, with these numbers increasing year on year (1,4). Due to its insidious onset and rapid progression, HCC is often diagnosed at an advanced stage, particularly in older patients with limited tolerance for invasive treatments (5,6). As a result, the prognosis for patients with HCC is generally unfavorable, with a low 5-year survival rate.

Although surgical resection and liver transplantation are curative treatments, most patients are unsuitable candidates. Targeted therapy and immunotherapy have improved the efficacy of HCC to a certain extent (7,8). Unfortunately, the survival rate of patients with HCC has not significantly improved in recent decades. Therefore, it is crucial to elucidate the molecular mechanisms underlying HCC development, identify actionable molecular targets, and develop effective targeted therapies. These advancements have the potential to improve patient prognosis and extend survival.

Long noncoding RNAs (lncRNAs), a major class of noncoding RNAs longer than 200 nucleotides, were initially considered transcriptional noise but are now recognized as key regulators of gene expression at multiple levels (9). Consequently, lncRNAs are now considered critically involved in regulating a wide array of diseases, including metabolic disorders, neurodegenerative diseases, and malignant tumors (10-12). Additionally, in 2011, Salmena et al. discovered the competitive endogenous RNA (ceRNA) mechanism, in which lncRNAs are able to sponge miRNAs to thus inhibit their regulation of target messenger RNA (mRNA) expression, a discovery which has greatly expanded the field of lncRNA research (13). lncRNA RMRP is a lncRNA that has tumor-promoting properties in a variety of malignancies (14,15), yet its regulatory mechanisms in HCC have not been extensively examined.

In this study, we aimed to investigate the role and mechanisms of lncRNA RMRP in HCC progression. Our preliminary data indicated that lncRNA RMRP is upregulated in HCC tissues compared to normal tissues. We further examined the effects of lncRNA RMRP knockdown on HCC cell proliferation, apoptosis, migration, and in vivo tumor growth. Additionally, we investigated the downstream mechanisms by which lncRNA RMRP exerts its effects, focusing on the potential regulatory pathway involving miR-3135a and its target gene SV2A. By performing functional rescue experiments and using a mouse xenograft model, we found that lncRNA RMRP regulates HCC development through the miR-3135a-SV2A axis. Our findings represent novel insights into the molecular mechanisms of HCC progression and the potential therapeutic targets for HCC treatment. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-259/rc).

Methods

Cell culture and collection of clinical samples

The human HCC cell line HepG2 was obtained from the American Type Culture Collection (ATCC, USA). The human HCC cell line HCCLM3 was established at the Liver Cancer Institute, Zhongshan Hospital, Fudan University, Shanghai, China. HepG2 cells were cultured in minimum essential medium (MEM) (with nonessential amino acids) (Gibco, USA), supplemented with 10% fetal bovine serum (FBS) (Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA). HCCLM3 cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) (Gibco, USA), supplemented with 10% FBS (Gibco, USA) and 1% penicillin-streptomycin (Gibco, USA). Three pairs of HCC tumor tissues and adjacent normal tissues were collected from Fudan University Shanghai Cancer Center. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. Human tissue samples were collected with approval from the Ethical Committee of Fudan University Shanghai Cancer Center (approval No. 2109243-5), and informed consent was taken from all the patients.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA from HCC and normal tissue samples and HCCLM3 or HepG2 cells were extracted using TRIzol reagent (Sigma-Aldrich). The quantification of RNA samples was evaluated with the Nanodrop 2000/2000C. Corresponding complement DNA (cDNA) was obtained via reverse transcription with HiScript QRT SuperMix for quantitative real-time polymerase chain reaction qRT-PCR (+gDNA WIPER, a component designed to remove genomic DNA contamination during reverse transcription). qRT-PCR was performed with AceQ qPCR SYBR Green Master Mix (Vazyme) and an RT-PCR instrument. The data were normalized by the corresponding reference and were analyzed with the 2^−ΔΔCt method. The primers used in qRT-PCR were as follows:

• LncRNA RMRP forward sequence (5'-3'), CTCCAAAGTCCGCCAAGA; lncRNA RMRP reverse sequence (5'-3'), TGCCTGCGTAACTAGAGGG;
• GADPH forward sequence (5'-3'), TGACTTCAACAGCGACACCCA; GADPH reverse sequence (5'-3'), CACCCTGTTGCTGTAGCCAAA;
• U6 forward sequence (5'-3'), CTCGCTTCGGCAGCACA; U6 reverse sequence (5'-3'), AACGCTTCACGAATTTGCGT;
• miR-3135a forward sequence (5'-3'), CGCGTGCCTAGGCTGAGACT; miR-3135a reverse sequence (5'-3'), AGTGCAGGGTCCGAGGTATT;
• SV2A forward sequence (5'-3'), TGTCTCCTGCTTCTTCCTGTCT; and SV2A reverse sequence (5'-3'), AGCTGTGGTCCTCTTGTCTGA.

Lentiviral vector construction

LncRNA RMRP sequence template was used for RNA interference target sequence design, and the knockdown sequence (shRMRP) and the negative control (NC) sequence (shCtrl) were ligated to the linear BR-V108 vector (Shanghai Yibeirui Biomedical Science and Technology, Shanghai, China). PCR verification and plasmid extraction were conducted. Cotransfection of the BR-V108, Helper 1.0, and Helper 2.0 plasmids into 293T cells was performed to generate the lentivirus. The lentiviral vectors (shCtrl and shRMRP) were transfected into HCCLM3 or HepG2 cells with Lipofectamine 2000 (Thermo Fisher Scientific). After 72 hours, transfection efficiency was determined via green fluorescent protein signal through fluorescence microscopy.

The miR-3135a mimics and inhibitors were purchased from Beijing Tsingke Biotech (Shanghai, China). The sequences for the miR-3135a mimic and its corresponding NC were designed according to standard protocols, with the mimic sequence being complementary to the endogenous miR-3135a. The inhibitor was an antisense oligonucleotide designed to specifically bind and inhibit endogenous miR-3135a. Transfection was performed using Lipofectamine 2000 according to the manufacturer’s instructions.

The lncRNA RMRP and SV2A overexpression lentiviral vector was constructed by cloning the full-length human SV2A cDNA into the BR-V003 and BR-V037 vectors (Shanghai Yibeirui Biomedical Science and Technology), respectively. The recombinant plasmid, along with the packaging plasmids Helper 1.0 and Helper 2.0, was cotransfected into 293T cells via Lipofectamine 2000 according to the manufacturer’s protocol to generate the lentivirus. The lentiviral vectors (NC and lncRNA RMRP or SV2A) were transfected into HCCLM3 or HepG2 cells via Lipofectamine 2000. After 72 hours, transfection efficiency was determined via green fluorescent protein signal through fluorescence microscopy.

Western blotting

Total cell proteins were extracted through precooled lysis buffer, and then concentration was detected with a bicinchoninic acid (BCA) protein assay kit (HyClone-Pierce). Western blotting was performed with an equal amount of each sample. Cell lysates (20 µg of total proteins per lane) were separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene fluoride (PVDF) membranes, and incubated with blocking liquid. Antibodies against P53 (1:2,000; cat. no. 10442-1-AP; Proteintech), caspase-3 (1:1,000; cat. no. 19677-1-AP; Proteintech), cleaved caspase-3 (1:1,000; cat. no. BM4620; Boster Bio), Bcl-XL (1:1,000; cat. no. 10783-1-AP; Proteintech), SV2A (1:1,000; cat. no. A03752-3; Boster Bio), and GAPDH (1:30,000; cat. no. 60004-1-Ig; Proteintech) were used as the primary antibodies for overnight incubation at 4 ℃. Corresponding horseradish peroxidase (HRP) goat anti-rabbit/mouse IgG polyclonal antibody (1:3,000; cat. no. A0208/A0216; Beyotime, China) was added for 1-hour incubation at room temperature, and then the membrane was imaged using Immobilon Western Chemiluminescent HRP Substrate (Millipore, USA).

Cell Counting Kit-8 (CCK-8) assay

Cells were counted using a cell counting plate, and cell suspension (2,000 cells/100 µL/well) was inoculated in a 96-well plate. The cells were cultured in an incubator (37 ℃, 5% CO₂) for a defined period of time. Prior to testing, 10 µL of CCK-8 solution (Sigma-Aldrich) was added to each well, and cells were incubated in the incubator for 1–4 hours. Absorbance at 450 nm was measured with a microplate reader.

EdU assay

The EdU assay was performed using the BeyoClick EdU-594 Cell Proliferation Detection Kit (Beyotime) according to the manufacturer’s instructions. Cells were seeded into six-well plates and incubated with EdU solution for 2 hours. After three washes with phosphate-buffered saline (PBS), the cells were fixed with 4% paraformaldehyde for 15 minutes at room temperature. Finally, DAPI reaction solution was used to stain the nuclei. The results were observed under an inverted fluorescence microscopy (Olympus, Tokyo, Japan). The proportion of positively stained EdU cells was calculated.

Cell apoptosis

After trypsin digestion, the cells were collected in a 5-mL centrifuge tube with the culture medium supernatant. After centrifugation at 1,300 rpm (~19 g) for 3 minutes, the supernatant was discarded; the cells were then washed with PBS once, centrifuged at 1,300 rpm (~19 g) for 3 minutes, collected, washed with 1× binding buffer once, centrifuged at 1,500 rpm (~19 g) for 3 minutes, and collected for flow cytometry analysis. The cells were resuspended with 200-µL (the final density of the cell suspension was 1×10⁶ to 1×10⁷ cells/mL) 1× apoptosis buffer. Subsequently, 5-µL of Annexin V-APC and 5 µL of propidium iodide (PI) were added and stained for 15 minutes. After staining, 800 µL of 1× apoptosis buffer was added, and 200 µL of cell suspension (three replicate wells in each group) was added to a 96-well plate for cell apoptosis detection via flow cytometry.

Cell cycle

Cells in each group were grown until coverage was approximately 80%. The cells were then collected and washed with PBS. After fixing with 70% alcohol for 1 hour, a staining solution (40× PI, 2 mg/mL; 100× RNase A, 10 mg/mL; 1× PBS, 25:10:1,000) was used for incubating the cells in the dark. Cell cycle distribution was detected via flow cytometry.

Wound-healing assay

Cells were plated (5×10⁵ cells/mL) and grew until 90% confluence. Scratches were performed with a 96-wounding replicator, and cells were cultured for another 48 hours for photography via a fluorescence micrograph. Migration distance was observed and analyzed with Cellomics (Thermo Fisher Scientific, USA) via a comparison to the migration area at 0 hour.

Transwell assay

For the Transwell assay, 1×10⁵ cells were seeded into the upper chamber, and a medium containing 30% FBS was added to the lower chamber to promote migration. After 24 hours, non-migrated cells on the upper side of the chamber were removed, and the cells that had adhered to the membrane were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. To evaluate migratory capacity, cell counts were performed in five randomly selected fields per group under a microscope.

Dual-luciferase reporter assay

Dual-luciferase reporter assays were performed to investigate the interaction between lncRNA RMRP and miR-3135a and that between miR-3135a and SV2A. The wild-type and mutant sequences of lncRNA RMRP and the 3' untranslated region (3' UTR) of SV2A containing the miR-3135a binding sites were cloned into the dual-luciferase miRNA target expression vector. 293T cells were cotransfected with the reporter plasmids and miR-3135a mimic or NC via Lipofectamine 2000. Forty-eight hours after transfection, luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega, USA) and normalized to Renilla luciferase activity.

The Cancer Genome Atlas (TCGA) bioinformatics analysis

In this study, bioinformatics analysis was performed to investigate the correlation between lncRNA RMRP and immune checkpoint genes CD274 (PD-L1), PDCD1LG2 (PD-L2), and CTLA4 in HCC tissues. Data were extracted from TCGA database (https://portal.gdc.cancer.gov/), which provides comprehensive genomic and transcriptomic profiles of various cancer types. The expression levels of lncRNA RMRP, CD274, PDCD1LG2, and CTLA4 were retrieved from the TCGA-LIHC (Liver Hepatocellular Carcinoma) dataset. Spearman’s correlation analysis was conducted to evaluate the relationships between lncRNA RMRP and the expression of CD274, PDCD1LG2, and CTLA4. Statistical significance was defined as a P value <0.05. All analyses were performed using R software (version 4.2.1) with appropriate packages for data processing and visualization. This approach allowed us to explore the potential regulatory roles of lncRNA RMRP in the tumor immune microenvironment of HCC.

Xenograft animal model

Experimental mice were obtained from Jiangsu Jicui Yaokang Biological Technology Co., Ltd (Nanjing, China). The mice were housed at 20–25 ℃ with a humidity of 60–70%, under specific pathogen-free conditions. A total of 10 BALB/c nude mice (4–6 weeks old, weighing 16–20 g) were used in the study. The mice were randomly divided into two groups (n=5 per group): the shRMRP group (lncRNA RMRP knockdown) and the shCtrl group (negative control). Each mouse served as an independent experimental unit. Randomization was performed using a random number table method. HCCLM3 cells with stable lentiviral infection (either shRMRP or shCtrl) were subcutaneously injected into the right back of each mouse. Investigators who measured tumor volumes and performed data analysis were blinded to group allocation to minimize bias. Tumor volume was recorded by measuring the longest dimension (L) and the dimension perpendicular to it (W), and calculated using the formula: volume = π/6 × L × W². At the endpoint, mice were euthanized via CO₂ asphyxiation, and tumors were harvested for further analysis. The sample size was determined based on commonly accepted practice in preliminary tumorigenesis studies, aiming to balance statistical power with ethical considerations. No formal a priori sample size calculation was performed. All animal experiments were conducted with the approval from the Ethics Committee of Fudan University Shanghai Cancer Center (No. JS-273), in compliance with institutional guidelines for the care and use of laboratory animals. A protocol was prepared before the study without registration.

Statistical analysis

All cell experiments were independently conducted in triplicate, and data are presented as the mean ± standard deviation (SD) (n≥3). The sample size for cell experiments was determined based on commonly accepted standards in biomedical research, aiming to ensure reproducibility and allow for appropriate statistical analyses. In animal experiments, a sample size of n=5 per group was selected to achieve a balance between statistical power and ethical considerations. Statistical analyses were performed using GraphPad Prism 6.0 software (Dotmatics, Boston, MA, USA). For comparisons between two groups, the unpaired Student t-test was used, while multiple-group comparisons were analyzed via one-way analysis of variance (ANOVA) and were followed by post hoc tests as appropriate. A P value <0.05 was considered to indicate statistical significance.

Results

LncRNA RMRP expression was upregulated in clinical tissues

First, we examined the expression of lncRNA RMRP in three pairs of HCC tumor tissues and normal tissues. The results demonstrated the upregulation of lncRNA RMRP in HCC tumor tissues, suggesting its potential involvement in tumor development (Figure 1A). To conduct an in vitro loss-of-function study, we prepared lentiviruses for lncRNA RMRP knockdown (shRMRP) and NC (shCtrl) and confirmed their efficiency through qRT-PCR analysis. As depicted in Figure 1B, lncRNA RMRP was effectively suppressed in HCCLM3 and HepG2 cells.

Figure 1 LncRNA RMRP was upregulated in HCC and could regulate HCC cell proliferation. (A) The expression of lncRNA RMRP was detected in three pairs of HCC tumor tissues and normal tissues. (B) The knockdown efficiency of lncRNA RMRP was evaluated in HCCLM3 and HepG2 cells via qRT-PCR. (C) CCK-8 assay was performed to test the cell proliferation of HCCLM3 and HepG2 cells with or without lncRNA RMRP knockdown. (D) EdU staining assay was used for indicating proliferating active cell population in the shCtrl and shRMRP groups of HCCLM3 and HepG2 cells. Magnification: 200×. Data are presented as the mean and standard deviation. *, P<0.05; ***, P<0.001. CCK-8, Cell Counting Kit-8; DAPI, 4',6-diamidino-2-phenylindole; EdU, 5-ethynyl-2'-deoxyuridine; HCC, hepatocellular carcinoma; lncRNA, long noncoding RNA; qRT-PCR, quantitative real-time polymerase chain reaction; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus.

Knockdown of lncRNA RMRP inhibited HCC progression in vitro

To evaluate the impact of lncRNA RMRP knockdown on cell proliferation, CCK-8 and EdU staining assays were conducted. According to the CCK-8 assay, lncRNA RMRP knockdown suppressed cell proliferation in both HCCLM3 and HepG2 cells (Figure 1C). Similarly, the proportion of EdU-positive cells was significantly reduced in the shRMRP groups of HCCLM3 and HepG2 cells as compared to the shCtrl groups (Figure 1D). These findings point to the crucial role of lncRNA RMRP in HCC cell proliferation. Flow cytometry was used to examine the impact of lncRNA RMRP knockdown on HCC cell apoptosis. The results revealed a significantly higher percentage of apoptotic cells in HCCLM3 and HepG2 cells with lncRNA RMRP knockdown as compared to the NC groups (Figure 2A). Additionally, lncRNA RMRP knockdown led to alterations in the expression of several apoptosis-related proteins in HCCLM3 and HepG2 cells. Specifically, p53 and cleaved caspase-3 were upregulated, while Bcl-XL was downregulated (Figure 2B). Furthermore, flow cytometry analysis of the cell cycle distribution in HCCLM3 and HepG2 cells indicated that lncRNA RMRP knockdown could induce G1 phase cell cycle arrest although the effect was less pronounced in HepG2 cells (Figure 2C). These findings suggest that lncRNA RMRP suppression can inhibit HCC cell proliferation by promoting G1 phase cell cycle arrest and inducing apoptosis. Subsequently, wound-healing and Transwell assays were both carried out to evaluate the regulation of cell migration by lncRNA RMRP. Both assays indicated that lncRNA RMRP knockdown decreased the migratory ability of HCC cells (Figure 3).

Figure 2 LncRNA RMRP knockdown promoted cell apoptosis and cell cycle arrest. (A) Apoptosis of HCCLM3 and HepG2 cells with or without lncRNA RMRP knockdown was detected via flow cytometry. (B) The expression of several apoptosis-related proteins including p53, caspase-3, cleaved caspase-3 (C-caspase-3), and Bcl-XL in the shCtrl and shRMRP groups of HCCLM3 and HepG2 cells was detected by WB. (C) Flow cytometry was used for examining the cell cycle distribution of HCCLM3 and HepG2 cells with or without lncRNA RMRP knockdown. Data are presented as the mean and standard deviation. *, P<0.05; **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; lncRNA, long noncoding RNA; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus; WB, Western blotting.

Figure 3 LncRNA RMRP knockdown suppressed cell migration. (A) Wound-healing assay and (B) Transwell assay (cells were stained with 0.1% crystal violet) were applied to assess the regulatory effects of lncRNA RMRP knockdown on HCC cell migration. Magnification: 100× for wound-healing assay, 200× for transwell assay. Data are presented as the mean and standard deviation. **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; lncRNA, long noncoding RNA; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus.

LncRNA RMRP could regulate SV2A expression through sponging miR-3135a

In order to clarify the downstream mechanism of lncRNA RMRP, we used RNAhybrid to match lncRNA RMRP with all human miRNA sequences, identifying miR-3135a as a potential downstream miRNA target. qRT-PCR in both HCCLM3 and HepG2 cells revealed that miR-3135a expression was significantly downregulated when lncRNA RMRP was overexpressed and was conversely upregulated when lncRNA RMRP was knocked down (Figure 4A,4B). This suggests a reverse regulatory relationship between lncRNA RMRP and miR-3135a. To further confirm the interaction between lncRNA RMRP and miR-3135a, we performed a dual-luciferase reporter assay, which confirmed the binding of lncRNA RMRP to miR-3135a (Figure 4C). Additionally, we hypothesized that lncRNA RMRP might regulate the expression of the downstream target SV2A by sponging miR-3135a and used the miRDB database to clarify the miRNA–target gene interactions. This hypothesis was confirmed through another dual-luciferase reporter assay, confirming the interaction between miR-3135a and SV2A (Figure 4D). Moreover, we found that treatment with miR-3135a mimic could significantly suppress SV2A mRNA level in HCC cells (Figure 4E,4F). We then assessed the protein expression levels of SV2A in five HCC tissue samples and five normal tissue samples and found that SV2A generally had a higher expression in tumor tissues than in normal tissues (Figure 4G). Furthermore, we examined SV2A expression in HCCLM3 and HepG2 cell lines with either knockdown or overexpression of lncRNA RMRP, observing a coexpression pattern between lncRNA RMRP and SV2A (Figure 4H). To elucidate the functional relationship between lncRNA RMRP and miR-3135a in regulating SV2A expression, we conducted rescue experiments using an miR-3135a inhibitor in conjunction with lncRNA RMRP knockdown. The results demonstrated that the upregulation of SV2A induced by lncRNA RMRP knockdown could be attenuated by the miR-3135a inhibitor (Figure 4I). Collectively, these findings indicate that lncRNA RMRP regulates SV2A expression through the sponging of miR-3135a, suggesting a downstream pathway and mechanism by which lncRNA RMRP may influence the progression of HCC.

Figure 4 LncRNA RMRP could regulate SV2A expression through sponging miR-3135a. (A) The expression of miR-3135a was detected via qRT-PCR in HCCLM3 cells with lncRNA RMRP knockdown or overexpression. (B) The expression of miR-3135a was detected via qRT-PCR in HepG2 cells with lncRNA RMRP knockdown or overexpression. (C) A dual-luciferase reporter assay was performed to confirm the interaction between lncRNA RMRP and miR-3135a. (D) A dual-luciferase reporter assay was performed to confirm the interaction between SV2A and miR-3135a. (E,F) The mRNA levels of SV2A were detected in HCCLM3 and HepG2 cells with or without treatment of miR-3135a mimic. (G) The protein expression of SV2A was detected in five HCC tissue samples and five normal tissue samples. (H) The protein expression of SV2A was detected in HCCLM3 and HepG2 cells with lncRNA RMRP knockdown or overexpression. (I) The protein expression of SV2A was detected in HCCLM3 and HepG2 cells with lncRNA RMRP knockdown, miR-3135a inhibition, or a combination of both. Data are presented as the mean and standard deviation. *, P<0.05; **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; Inhibitor, HCC cells transfected with inhibitor of miR-3135a for miR-3135a knockdown; lncRNA, long noncoding RNA; lnc-RMRP-MUT, promotor of lncRNA RMRP with indicated mutation; lnc-RMRP-WT, wild type promotor of lncRNA RMRP; Mimic, HCC cells transfected with Mimic of miR-3135a for miR-3135a overexpression; NC, HCC cells transfected with empty lentivirus; NC-miR, HCC cells transfected with negative control vector; qRT-PCR, quantitative real-time polymerase chain reaction; RMRP, HCC cells transfected with lncRNA RMRP overexpression lentivirus; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus; SV2A-MUT, promotor of SV2A with indicated mutation; SV2A-WT, wild type promotor of SV2A.

LncRNA RMRP/miR-3135a/SV2A could regulate HCC development and the immune microenvironment

After clarifying the interactions and regulatory relationships within the lncRNA RMRP-miR-3135a-SV2A axis, we conducted a series of functional rescue experiments to further investigate their roles in HCC progression. First, HCCLM3 and HepG2 cells were transfected with lncRNA RMRP knockdown constructs, SV2A overexpression vectors (Figure 5A,5B), or their combination. The results from the CCK-8 assays indicated that SV2A overexpression significantly promoted cell proliferation (Figure 5C). Additionally, SV2A overexpression was able to reverse the proliferation inhibition induced by lncRNA RMRP knockdown (Figure 5C). In another set of experiments, HCC cells were transfected with SV2A overexpression lentivirus and miR-3135a mimics, either individually or in combination (Figure 5D). The findings revealed that SV2A overexpression could counteract the suppression of cell proliferation caused by the miR-3135a mimics. These results collectively confirm the regulatory role of the lncRNA RMRP-miR-3135a-SV2A axis in HCC progression and clarify the downstream regulatory mechanisms of lncRNA RMRP. This axis appears to play a critical role in modulating cell proliferation, which highlights its potential as a therapeutic target in HCC. More importantly, further correlation based on TCGA database revealed a positive association of lncRNA RMRP with several immune checkpoints including CD274 (PD-L1), PDCD1LG2 (PD-L2), and CTLA4 (Figure 5E).

Figure 5 LncRNA RMRP could regulate HCC development through the miR-3135a-SV2A axis. (A,B) The overexpression efficiency of SV2A was evaluated through qRT-PCR and WB assays. (C) The CCK-8 assay was performed on HCC cells with the indicated treatment to reveal the regulation of HCC cell proliferation via the lncRNA RMRP/SV2A axis. (D) The CCK-8 assay was performed on HCC cells with the indicated treatment to assess the regulation of HCC cell proliferation via the miR-3135a-SV2A axis. (E) The expression correlation between lncRNA RMRP and immune checkpoints, including CD274 (PD-L1), PDCD1LG2 (PD-L2), and CTLA4, was analyzed based on the TCGA database. Data are presented as the mean and standard deviation. **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; lncRNA, long noncoding RNA; miR-3135a mimic, HCC cells transfected with Mimic of miR-3135a for miR-3135a overexpression; NC, HCC cells transfected with empty lentivirus; OD, optical density; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus; SV2A (SV2A-OE), HCC cells transfected with SV2A overexpression lentivirus.

Knockdown of lncRNA RMRP suppressed HCC development in vivo

A mouse xenograft model was established to validate the role of lncRNA RMRP in HCC progression in vivo. HCCLM3 cells with lncRNA RMRP knockdown and control cells (NCs) were subcutaneously injected into nude mice. Tumor volume was monitored and recorded at regular intervals throughout the experiment. The results indicated that xenografts derived from lncRNA RMRP-knockdown HCCLM3 cells exhibited significantly slower growth rates as compared to those from the NC group (Figure 6A). After the mice were killed, the tumors were excised, photographed, and weighed to further assess the impact of lncRNA RMRP knockdown on tumor development (Figure 6B,6C). These findings provide evidence that lncRNA RMRP suppression effectively inhibits HCC growth in vivo, underscoring its potential role in HCC progression.

Figure 6 LncRNA RMRP knockdown inhibited HCC development in vivo. (A) Tumor volume was recorded at the indicated time points during the animal culturing. (B,C) After the mice were killed, the xenografts were collected for (B) weighing and (C) photographing. **, P<0.01; ***, P<0.001. HCC, hepatocellular carcinoma; lncRNA, long noncoding RNA; shCtrl, HCC cells transfected with negative control lentivirus; shRMRP, HCC cells transfected with lncRNA RMRP knockdown lentivirus.

Discussion

HCC is one of the most incident and lethal malignancies worldwide. This is primarily attributable to a lack of understanding regarding its molecular mechanisms and development and the paucity of effective molecular targeted drugs. The development of HCC is a multistep, multifactor process. Maintaining the dynamic balance between the proliferation and apoptosis of hepatocytes depends on the co-regulation of oncogenes, tumor-suppressor genes, and growth factors.

Extensively studied lncRNAs such as MALAT1 and TUG1 have been confirmed to exert significant regulatory effects in HCC progression (16,17). Lv et al. review various lncRNAs and their regulatory effects during different stages of HCC metastasis, including primary tumor growth, angiogenesis, epithelial-mesenchymal transition, and invasion. They suggested that lncRNAs could serve as valuable diagnostic and therapeutic targets in HCC (18). Fei et al. found that PWRN1 inhibits HCC proliferation by binding to PKM2, maintaining its high-activity tetramer state, preventing nuclear translocation of low-activity PKM2 dimers, reducing c-Myc-mediated LDHA expression and lactate production, and suppressing aerobic glycolysis, with TEPP-46 further enhancing this antitumor effect by stabilizing PKM2 tetramers and increasing pyruvate kinase activity (19). One study demonstrated that the novel oncogene USP27X-AS1 is highly expressed in patients with HCC and predictive of poor prognosis, promoting HCC cell proliferation and metastasis by enabling USP7 to interact with AKT to reduce AKT poly-ubiquitylation and enhance its protein stability. Moreover, SP1 binds to the USP27X-AS1 promoter to activate its transcription, suggesting USP27X-AS1 is a potential biomarker and treatment target for HCC (20). Although lncRNAs exhibit diverse mechanisms of gene regulation in tumors, including epigenetic modifications and posttranslational modifications, the ceRNA pathway has been more extensively investigated. In HCC, clarifying the role of lncRNAs in tumor progression through the ceRNA mechanism holds considerable research relevance. Notably, the lnc171-miR-873-5p-ZEB1 and LINC01094-miR-122-5p-TGFBR2 signaling axes have recently emerged as key regulators in HCC progression (21,22). Among the large number of lncRNAs, lncRNA RMRP has received particular attention. It has been demonstrated to play an important regulatory role in a variety of human diseases, including sepsis (23), diabetic nephropathy (24), spinal cord injury (25), Alzheimer’s disease (AD) (26), and hypoxia-induced myocardial injury (27). Studies also indicate that lncRNA RMRP exerts its regulatory effect mainly through ceRNA-related mechanisms. Tumors are another focus of lncRNA RMRP-related research, and a number of studies have shown that lncRNA RMRP is critically involved in non-small cell lung cancer (28,29), esophageal squamous cell carcinoma (14), bladder cancer (30), and glioma (31). In our study, the expression of lncRNA RMRP was increased in malignant tumors compared to normal tissues and promoted tumor progression. Although no conflicting reports on the oncogenic role of RMRP in cancers have been identified, studies in non-cancer diseases suggest functional differences. For example, in AD, RMRP promotes neuronal apoptosis and autophagy via the miR-3142/TRIB3 axis. Knockdown of RMRP inhibited these processes, suggesting that its biological functions may vary across different disease contexts (26).

A number of other studies have examined the function of lncRNA RMRP in HCC. Although Shao et al. reported that lncRNA RMRP functions as a tumor suppressor in HCC (32), other studies have found that lncRNA RMRP promotes the progression of HCC (33,34). In order to obtain deeper insights into the function of lncRNA RMRP in HCC, we detected its expression in tumor and normal tissues and observed its upregulation in tumor tissues. Knockdown of lncRNA RMRP consistently inhibited HCC cell proliferation, promoted cell apoptosis, and suppressed cell migration. In line with the in vitro study, the growth of tumors formed by HCC cells with lncRNA RMRP knockdown was also slowed. Our findings suggest that lncRNA RMRP exerts a critical mediating effect in HCC progression and that the inhibition or silencing of its expression may be a promising tumor-suppression strategy. Therefore, lncRNA RMRP has the potential to be a molecular target in the treatment of HCC. Therefore, subsequent research should clarify its downstream mechanisms that regulate the malignant phenotypes of HCC cells in order to establish a more direct association between lncRNA RMRP and HCC progression.

The role of lncRNAs in cancer biology often involves their function as ceRNAs that sponge miRNAs, thus modulating the expression of downstream target genes. This ceRNA mechanism is a critical regulatory pathway in tumor biology, including HCC (35). Our findings corroborate the existence of this mechanism, demonstrating that lncRNA RMRP promotes HCC progression by sponging miR-3135a, which in turn regulates the expression of SV2A. We found that the knockdown of lncRNA RMRP resulted in reduced SV2A expression and that SV2A overexpression could counteract the effects of lncRNA RMRP knockdown on HCC cell proliferation and migration. This indicates that the lncRNA RMRP-miR-3135a-SV2A axis plays a pivotal role in HCC progression.

Synaptic vesicle glycoprotein 2A (SV2A) is a member of a protein family that figures prominently in synaptic vesicle function, including neurotransmitter release, exocytosis regulation, calcium sensitivity, and interactions with the extracellular matrix (36). SV2A is ubiquitously expressed in synaptic vesicles across the nervous system and maintains critical functions in synaptic integrity (37). The role of SV2A in various cancers outside the nervous system is gaining increased research attention (38,39). For example, SV2A has been implicated in regulating neural stem cell survival via the p53 signaling pathway, and its upregulation has been associated with neuroendocrine differentiation in prostate cancer, serving as a marker for positron emission tomography imaging (40). Additionally, in patients with glioma and epilepsy, SV2A expression levels correlate with the clinical response to levetiracetam, indicating its potential as a predictive biomarker for treatment efficacy (41).

In our study of HCC, SV2A was established as a downstream target of the lncRNA RMRP-miR-3135a axis, which has significant implications for tumor progression. The observed upregulation of SV2A in HCC tissues and its role in promoting cell proliferation and migration further suggest that SV2A could be a valuable target for therapeutic intervention. Future research should focus on comprehensively elucidating the role of SV2A in HCC and exploring the therapeutic potential of targeting the lncRNA RMRP-miR-3135a-SV2A axis. By integrating these findings with existing knowledge on SV2A’s role in other cancers and neurological diseases, we can better understand its multifaceted functions and develop more effective treatment strategies for HCC.

HCC exhibits significant biological heterogeneity influenced by the etiology of the underlying liver disease, such as viral infections, metabolic dysfunction, or alcohol-related liver injury. This heterogeneity contributes to differences in tumor behavior and systemic treatment responses (42,43). Therefore, identifying biomarkers like lncRNAs that reflect disease biology could be valuable for guiding personalized therapeutic strategies in HCC patients. One recent study demonstrated that certain lncRNAs can modulate the sensitivity of cancer cells to chemotherapeutic agents, including capecitabine, a prodrug of 5-fluorouracil (44). In particular, metronomic administration of capecitabine has shown promising anti-tumor efficacy and favorable safety profiles in advanced HCC patients who failed first-line sorafenib therapy (45-47). Although our current study mainly focuses on the role of the RMRP-miR-3135a-SV2A axis in HCC progression, it is conceivable that RMRP may also participate in modulating responses to systemic therapies, including capecitabine. Future studies are warranted to explore whether RMRP expression could serve as a predictive biomarker for treatment sensitivity, thus providing novel insights into optimizing systemic therapies for HCC patients in the era of precision medicine.

Conclusions

Our study highlights the prominent role of lncRNA RMRP in the progression of HCC. We observed that lncRNA RMRP was upregulated in HCC tissues, suggesting its involvement in tumor development. Functional assays revealed that the knockdown of lncRNA RMRP inhibits HCC cell proliferation, induces apoptosis, and reduces cell migration in vitro. In terms of mechanism, we demonstrated that lncRNA RMRP regulates the expression of SV2A by sponging miR-3135a, forming a regulatory axis that influences HCC progression. Notably, lncRNA RMRP demonstrated a slight, positive correlation with several immune checkpoints. Moreover, in vivo studies with a mouse xenograft model showed that lncRNA RMRP knockdown significantly suppressed tumor growth. Collectively, our findings provide new insights into the molecular mechanisms of HCC and point to the lncRNA RMRP-miR-3135a-SV2A axis as a potential therapeutic target for HCC treatment.

Nevertheless, this study has some limitations. First, the expression and functional effects of lncRNA RMRP were mainly validated in two HCC cell lines and a limited number of clinical tissue samples. Future studies with larger cohorts and additional HCC models are needed to further confirm our findings. Second, while we elucidated the lncRNA RMRP-miR-3135a-SV2A axis, the broader regulatory network and potential upstream modulators of RMRP in HCC remain to be explored.

Acknowledgments

We are grateful to all the participants who took part in this study.

Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-259/rc

Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-259/dss

Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-259/prf

Funding: This work was supported by grants from the National Natural Science Foundation of China (No. 82272095) and Shanghai Anticancer Association SOAR PROJECT (No. SACA-AX202203).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-259/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. Human tissue samples were collected with approval from the Ethical Committee of Fudan University Shanghai Cancer Center (approval No. 2109243-5), and informed consent was taken from all the patients. All animal experiments were performed under a project license (No. JS-273) granted by the Ethics Committee of Fudan University Shanghai Cancer Center, in compliance with institutional guidelines for the care and use of laboratory animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin 2024;74:229-63. [Crossref] [PubMed]
2. He S, Xia C, Li H, et al. Cancer profiles in China and comparisons with the USA: a comprehensive analysis in the incidence, mortality, survival, staging, and attribution to risk factors. Sci China Life Sci 2024;67:122-31. [Crossref] [PubMed]
3. Vogel A, Meyer T, Sapisochin G, et al. Hepatocellular carcinoma. Lancet 2022;400:1345-62. [Crossref] [PubMed]
4. Alawyia B, Constantinou C. Hepatocellular Carcinoma: a Narrative Review on Current Knowledge and Future Prospects. Curr Treat Options Oncol 2023;24:711-24. [Crossref] [PubMed]
5. Feng F, Zhao Y. Hepatocellular Carcinoma: Prevention, Diagnosis, and Treatment. Med Princ Pract 2024;33:414-23. [Crossref] [PubMed]
6. Wang Y, Deng B. Hepatocellular carcinoma: molecular mechanism, targeted therapy, and biomarkers. Cancer Metastasis Rev 2023;42:629-52. [Crossref] [PubMed]
7. Brown ZJ, Tsilimigras DI, Ruff SM, et al. Management of Hepatocellular Carcinoma: A Review. JAMA Surg 2023;158:410-20. [Crossref] [PubMed]
8. Ganesan P, Kulik LM. Hepatocellular Carcinoma: New Developments. Clin Liver Dis 2023;27:85-102. [Crossref] [PubMed]
9. Nemeth K, Bayraktar R, Ferracin M, et al. Non-coding RNAs in disease: from mechanisms to therapeutics. Nat Rev Genet 2024;25:211-32. [Crossref] [PubMed]
10. Wu J, Chen Q, Wang Y, et al. LINC01977 promotes colorectal cancer growth and metastasis by enhancing aerobic glycolysis via the ERK/c-Myc axis. J Gastrointest Oncol 2024;15:271-85. [Crossref] [PubMed]
11. Ferrer J, Dimitrova N. Transcription regulation by long non-coding RNAs: mechanisms and disease relevance. Nat Rev Mol Cell Biol 2024;25:396-415. [Crossref] [PubMed]
12. Statello L, Guo CJ, Chen LL, et al. Gene regulation by long non-coding RNAs and its biological functions. Nat Rev Mol Cell Biol 2021;22:96-118. [Crossref] [PubMed]
13. Salmena L, Poliseno L, Tay Y, et al. A ceRNA hypothesis: the Rosetta Stone of a hidden RNA language? Cell 2011;146:353-8. [Crossref] [PubMed]
14. Tan Z, Luan S, Wang X, et al. Mechanism study of lncRNA RMRP regulating esophageal squamous cell carcinoma through miR-580-3p/ATP13A3 axis. Discov Oncol 2024;15:150. [Crossref] [PubMed]
15. Hussen BM, Azimi T, Hidayat HJ, et al. Long Non-coding RNA RMRP in the Pathogenesis of Human Disorders. Front Cell Dev Biol 2021;9:676588. [Crossref] [PubMed]
16. Golam RM, Khalil MAF, Shaker OG, et al. The clinical significance of long non-coding RNAs MALAT1 and CASC2 in the diagnosis of HCV-related hepatocellular carcinoma. PLoS One 2024;19:e0303314. [Crossref] [PubMed]
17. Farzaneh M, Ghasemian M, Ghaedrahmati F, et al. Functional roles of lncRNA-TUG1 in hepatocellular carcinoma. Life Sci 2022;308:120974. [Crossref] [PubMed]
18. Lv E, Sheng J, Yu C, et al. LncRNA influence sequential steps of hepatocellular carcinoma metastasis. Biomed Pharmacother 2021;136:111224. [Crossref] [PubMed]
19. Fei M, Li X, Liang S, et al. LncRNA PWRN1 inhibits the progression of hepatocellular carcinoma by activating PKM2 activity. Cancer Lett 2024;584:216620. [Crossref] [PubMed]
20. Su C, Zhang H, Mo J, et al. SP1-activated USP27X-AS1 promotes hepatocellular carcinoma progression via USP7-mediated AKT stabilisation. Clin Transl Med 2024;14:e1563. [Crossref] [PubMed]
21. Yang X, Xu C, Liu C, et al. TGF-β1-Induced LINC01094 promotes epithelial-mesenchymal transition in hepatocellular carcinoma through the miR-122-5p/TGFBR2-SAMD2-SMAD3 Axis. Funct Integr Genomics 2024;24:123. [Crossref] [PubMed]
22. Huang S, Liao Z, He X, et al. Ethanol responsive lnc171 promotes migration and invasion of HCC cells via mir-873-5p/ZEB1 axis. BMC Cancer 2024;24:550. [Crossref] [PubMed]
23. Han Y, Cai Y, Lai X, et al. lncRNA RMRP Prevents Mitochondrial Dysfunction and Cardiomyocyte Apoptosis via the miR-1-5p/hsp70 Axis in LPS-Induced Sepsis Mice. Inflammation 2020;43:605-18. [Crossref] [PubMed]
24. Yang H, Wang J, Zhang Z, et al. Sp1-Induced lncRNA Rmrp Promotes Mesangial Cell Proliferation and Fibrosis in Diabetic Nephropathy by Modulating the miR-1a-3p/JunD Pathway. Front Endocrinol (Lausanne) 2021;12:690784. [Crossref] [PubMed]
25. Hong H, Xu G, Chen J, et al. LncRNA RMRP Contributes to the Development and Progression of Spinal Cord Injury by Regulating miR-766-5p/FAM83A Axis. Mol Neurobiol 2022;59:6200-10. [Crossref] [PubMed]
26. Tang ZB, Chen HP, Zhong D, et al. LncRNA RMRP accelerates autophagy-mediated neurons apoptosis through miR-3142/TRIB3 signaling axis in alzheimer's disease. Brain Res 2022;1785:147884. [Crossref] [PubMed]
27. Teng Y, Ding M, Wang X, et al. LncRNA RMRP accelerates hypoxia-induced injury by targeting miR-214-5p in H9c2 cells. J Pharmacol Sci 2020;142:69-78. [Crossref] [PubMed]
28. Yu H, Zhang Z. ALKBH5-mediated m6A demethylation of lncRNA RMRP plays an oncogenic role in lung adenocarcinoma. Mamm Genome 2021;32:195-203. [Crossref] [PubMed]
29. Yin H, Chen L, Piao S, et al. M6A RNA methylation-mediated RMRP stability renders proliferation and progression of non-small cell lung cancer through regulating TGFBR1/SMAD2/SMAD3 pathway. Cell Death Differ 2023;30:605-17. [Crossref] [PubMed]
30. Gao Y, Zhang X, Wang X, et al. The clinical value of rapidly detecting urinary exosomal lncRNA RMRP in bladder cancer with an RT-RAA-CRISPR/Cas12a method. Clin Chim Acta 2024;562:119855. [Crossref] [PubMed]
31. Grady CI, Walsh LM, Heiss JD. Mitoepigenetics and gliomas: epigenetic alterations to mitochondrial DNA and nuclear DNA alter mtDNA expression and contribute to glioma pathogenicity. Front Neurol 2023;14:1154753. [Crossref] [PubMed]
32. Shao C, Liu G, Zhang X, et al. Long Noncoding RNA RMRP Suppresses the Tumorigenesis of Hepatocellular Carcinoma Through Targeting microRNA-766. Onco Targets Ther 2020;13:3013-24. [Crossref] [PubMed]
33. Yukimoto A, Watanabe T, Sunago K, et al. The long noncoding RNA of RMRP is downregulated by PERK, which induces apoptosis in hepatocellular carcinoma cells. Sci Rep 2021;11:7926. [Crossref] [PubMed]
34. Hongfeng Z, Andong J, Liwen S, et al. lncRNA RMRP knockdown suppress hepatocellular carcinoma biological activities via regulation miRNA-206/TACR1. J Cell Biochem 2020;121:1690-702. [Crossref] [PubMed]
35. Qi X, Zhang DH, Wu N, et al. ceRNA in cancer: possible functions and clinical implications. J Med Genet 2015;52:710-8. [Crossref] [PubMed]
36. Yu H, Han Y, Cui C, et al. Loss of SV2A promotes human neural stem cell apoptosis via p53 signaling. Neurosci Lett 2023;800:137125. [Crossref] [PubMed]
37. Bavarsad MS, Grinberg LT. SV2A PET imaging in human neurodegenerative diseases. Front Aging Neurosci 2024;16:1380561. [Crossref] [PubMed]
38. Liu Y, Zhang D, Kong M, et al. Synaptic vesicle protein 2-targeted doxorubicin-loaded liposome for effective neuroblastoma therapy. Biomed Pharmacother 2024;180:117548. [Crossref] [PubMed]
39. Du Y, Li R, Fu D, et al. Multi-omics technologies and molecular biomarkers in brain tumor-related epilepsy. CNS Neurosci Ther 2024;30:e14717. [Crossref] [PubMed]
40. Guan B, Zhou N, Wu CY, et al. Validation of SV2A-Targeted PET Imaging for Noninvasive Assessment of Neuroendocrine Differentiation in Prostate Cancer. Int J Mol Sci 2021;22:13085. [Crossref] [PubMed]
41. de Groot M, Aronica E, Heimans JJ, et al. Synaptic vesicle protein 2A predicts response to levetiracetam in patients with glioma. Neurology 2011;77:532-9. [Crossref] [PubMed]
42. Behrens S, Wang XW. Dissecting intratumor heterogeneity in HCC: new research strategies and clinical implications. Carcinogenesis 2022;43:1103-9. [Crossref] [PubMed]
43. Dhanasekaran R. Deciphering Tumor Heterogeneity in Hepatocellular Carcinoma (HCC)-Multi-Omic and Singulomic Approaches. Semin Liver Dis 2021;41:9-18. [Crossref] [PubMed]
44. Vaghari-Tabari M, Qujeq D, Hashemzadeh MS. Long noncoding RNAs as potential targets for overcoming chemoresistance in upper gastrointestinal cancers. Biomed Pharmacother 2024;179:117368. [Crossref] [PubMed]
45. Trevisani F, Brandi G, Garuti F, et al. Metronomic capecitabine as second-line treatment for hepatocellular carcinoma after sorafenib discontinuation. J Cancer Res Clin Oncol 2018;144:403-14. [Crossref] [PubMed]
46. Granito A, Marinelli S, Terzi E, et al. Metronomic capecitabine as second-line treatment in hepatocellular carcinoma after sorafenib failure. Dig Liver Dis 2015;47:518-22. [Crossref] [PubMed]
47. Stefanini B, Bucci L, Santi V, et al. Sorafenib and Metronomic Capecitabine in Child-Pugh B patients with advanced HCC: A real-life comparison with best supportive care. Dig Liver Dis 2024;56:1582-91. [Crossref] [PubMed]

(English Language Editor: J. Gray)