Non-structural maintenance of chromosome condensin I complex subunit H knockdown suppresses malignant progression of esophageal squamous cell carcinoma via the Wnt/β-catenin signaling pathway
Original Article

Non-structural maintenance of chromosome condensin I complex subunit H knockdown suppresses malignant progression of esophageal squamous cell carcinoma via the Wnt/β-catenin signaling pathway

Yang Xu1,2# ORCID logo, Ao Guo2# ORCID logo, Jing Yang3 ORCID logo, Mingjun Zhang1# ORCID logo, Bin Yuan2,4# ORCID logo

1Department of Medical Oncology, The Second Affiliated Hospital of Anhui Medical University, Hefei, China; 2Department of Pharmacology, School of Pharmaceutical Sciences, Anhui Medical University, Hefei, China; 3Experimental Teaching Center for Preventive Medicine, School of Public Health, Anhui Medical University, Hefei, China; 4The First Department of Critical Care Medicine, The Second Affiliated Hospital of Anhui Medical University, Hefei, China

Contributions: (I) Conception and design: ; (II) Administrative support: ; (III) Provision of study materials or patients: ; (IV) Collection and assembly of data: ; (V) Data analysis and interpretation: ; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors.

#These authors contributed equally to this work.

Correspondence to: Mingjun Zhang. Department of Medical Oncology, The Second Affiliated Hospital of Anhui Medical University, Road, Hefei 230031, China. Email: 19965397602@163.com.

Background: Esophageal squamous cell carcinoma (ESCC) remains a major cause of cancer-related mortality, and effective therapeutic targets are still limited. Non-structural maintenance of chromosome condensin I complex subunit H (NCAPH) has been implicated in tumorigenesis; however, its clinical relevance, functional roles, and underlying mechanisms in ESCC are not fully defined. We aimed to characterize the expression pattern, prognostic value, biological functions, and mechanistic basis of NCAPH in ESCC.

Methods: Public datasets from The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO) were analyzed to evaluate NCAPH expression and clinical associations. Single-cell RNA sequencing (scRNA-seq) data were used to map cell-type-specific distribution of NCAPH in tumor and adjacent tissues. NCAPH was silenced in KYSE150 and KYSE510 cells using lentiviral short hairpin RNAs (shRNAs), followed by Cell Counting Kit-8 (CCK-8), colony formation, wound-healing, and Transwell migration/invasion assays. A nude mouse xenograft model was established to assess the effect of NCAPH knockdown in vivo. RNA sequencing (RNA-seq), quantitative polymerase chain reaction (qPCR), western blotting, and enzyme-linked immunosorbent assay (ELISA) were performed to explore potential mechanisms.

Results: NCAPH was consistently upregulated in ESCC across multiple cohorts and was associated with unfavorable clinicopathological features and poorer survival. Functional assays demonstrated that NCAPH knockdown significantly inhibited ESCC cell proliferation, migration, invasion, and clonogenic growth. In vivo, NCAPH silencing suppressed xenograft tumor growth. Mechanistically, transcriptomic profiling and molecular validation indicated attenuation of Wnt/β-catenin signaling following NCAPH depletion, accompanied by reduced β-catenin and downstream targets.

Conclusions: NCAPH promotes malignant progression of ESCC, at least in part through activation of the Wnt/β-catenin pathway, and may serve as a potential biomarker and therapeutic target.

Keywords: Esophageal squamous cell carcinoma (ESCC); non-structural maintenance of chromosome condensin I complex subunit H (NCAPH); Wnt/β-catenin signaling pathway


Submitted Dec 20, 2025. Accepted for publication Apr 08, 2026. Published online Jun 11, 2026.

doi: 10.21037/jgo-2025-1-1060


Highlight box

Key findings

• Non-structural maintenance of chromosome condensin I complex subunit H (NCAPH) is upregulated in esophageal squamous cell carcinoma (ESCC) and is associated with aggressive clinicopathological features.

• NCAPH knockdown suppresses ESCC cell proliferation, migration, invasion, colony formation, and xenograft growth.

What is known and what is new?

• Condensin subunit NCAPH contributes to malignant behavior in several cancers, but its role in ESCC has not been fully defined.

• NCAPH promotes ESCC progression at least in part through activation of the Wnt/β-catenin pathway.

What is the implication, and what should change now?

• NCAPH may serve as a biomarker and a potential therapeutic target for ESCC; strategies that inhibit NCAPH could attenuate Wnt/β-catenin signaling and tumor aggressiveness.


Introduction

Esophageal cancer ranks seventh in incidence and fifth in mortality within the spectrum of malignancies in China (1). Each year, approximately 180,000 individuals in China die from esophageal cancer. Esophageal squamous cell carcinoma (ESCC) is the most common histological type, accounting for over 90% of all esophageal cancer cases in the country (2,3). Despite advances in esophageal cancer diagnosis and treatment, the prognosis for ESCC remains poor, with persistently low 5-year survival rates (4). Therefore, identifying new therapeutic targets is essential to improve clinical outcomes in the management of esophageal cancer (5-7).

Condensin is a protein complex that governs chromosomal dynamics during mitosis, particularly in processes such as chromosome condensation and segregation (8,9). The condensin complex exists in two distinct forms: condensin I and condensin II. The condensin I protein complex comprises non-structural maintenance of chromosome condensin I complex subunit D2 (NCAPD2), non-structural maintenance of chromosome condensin I complex subunit G (NCAPG) and non-structural maintenance of chromosome condensin I complex subunit H (NCAPH), while the condensin II protein complex consists of NCAPD3, NCAPG2, and NCAPH2. Each subunit of condensin I and condensin II complexes is evolutionarily conserved from yeast to humans (10-12). These two condensin complexes differ in their timing and localization during the cell cycle: condensin II mainly resides in the nucleus during interphase and associates with chromosomes throughout mitosis, whereas condensin I associates with chromosomes after nuclear envelope breakdown. However, components of the condensin I protein complex also localize to the nucleus during interphase and have been implicated in gene regulation and chromosome condensation (13).

NCAPH, a member of the Barren (CAP-H) family of genes located at chromosome 2q11.2, plays a key role in mitotic chromosome condensation, structural organization, and cell cycle progression (14). NCAPH is implicated in maintaining chromosomal stability and regulating DNA damage responses during mitosis in normal cells. Its interaction with hCAP-D2 is essential for accurate chromosome assembly and segregation (15). The first step of mitosis is triggered by a reduction in hCAP-D2, which disrupts NCAPH-chromosome binding and leads to mitotic abnormalities, including delayed prophase entry, defective chromatid separation, and errors in chromosome segregation (16).

Studies have identified NCAPH as a contributor to tumorigenesis in various malignancies (14,17,18), including breast cancer (19-21), non-small cell lung cancer (22-24), cervical cancer (25,26), and colorectal cancer (27-29), among others (30,31). However, the relationship between NCAPH and esophageal cancer needs to be elucidated.

The Wnt/β-catenin pathway has been implicated in ESCC progression and treatment resistance, and recent studies continue to highlight its importance as a therapeutic axis in esophageal cancer (32-35).

In this study, NCAPH expression in ESCC and adjacent tissues was investigated using tissue microarrays and bioinformatics analyses. The results revealed elevated NCAPH expression in tumor tissues compared to adjacent normal tissues, and high NCAPH expression correlated with poor patient survival. Functional assays demonstrated that NCAPH knockdown significantly inhibited proliferation, migration, invasion, and colony formation in KYSE150 and KYSE510 cell lines. In vivo experiments in nude mice showed reduced tumor growth upon NCAPH silencing. These findings suggest that NCAPH plays a key role in ESCC progression and may represent a novel therapeutic target for this cancer. To address this gap, the present study provides a multi-level characterization of NCAPH in ESCC. Specifically, we integrated multiple public cohorts [The Cancer Genome Atlas (TCGA) and Gene Expression Omnibus (GEO)] to confirm NCAPH upregulation and its prognostic relevance, leveraged scRNA-seq data to map cell-type-specific expression patterns, validated protein expression and clinicopathological associations using tissue microarrays, and performed functional assays in ESCC cell lines together with in vivo xenograft experiments. Importantly, we further investigated the mechanistic link between NCAPH and the Wnt/β-catenin signaling pathway. These results collectively support NCAPH as a potential therapeutic target in ESCC. We present this article in accordance with the MDAR and ARRIVE reporting checklists (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1060/rc).


Methods

Study design and reporting

This study included RNA sequencing (RNA-seq), Cell Counting Kit-8 (CCK-8), colony formation, wound healing, Transwell migration/invasion, western blotting, quantitative polymerase chain reaction (qPCR), enzyme-linked immunosorbent assay (ELISA), hematoxylin and eosin (H&E), immunohistochemical (IHC), and nude‑mouse xenograft assays. We report materials, experimental design, and statistical analyses for animal experiments.

Downloading and processing of single-cell sequencing data

This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. We downloaded the GSE196756 dataset (six samples) from GEO and processed it in Seurat (R v4.5.1, Seurat v5.3.0). We normalized the data using LogNormalize, identified 1,500 highly variable genes, and performed principal component analysis (PCA) for dimensionality reduction. We constructed a KNN graph based on 13 principal components (PCs) and identified clusters using FindNeighbors/FindClusters at a resolution of 3.0. We visualized clusters using Uniform Manifold Approximation and Projection (UMAP). We did not apply additional filtering based on feature counts or mitochondrial percentage, and we excluded genes expressed in fewer than three cells. We did not specifically remove doublets; instead, we relied on downstream clustering and marker-based annotation to minimize potential doublet effects. We manually annotated cell types using canonical marker genes reported in the literature, as listed in Table S1. Finally, we used FeaturePlot to visualize NCAPH expression across annotated cell populations.

Cell culture

This study utilized two ESCC cell lines (KYSE150 and KYSE510) and 293T cells, cultured in RPMI-1640 and DMEM (Gibco), respectively. All cells were grown at 37 ℃ with 5% CO2, using media supplemented with 10% fetal bovine serum (FBS) (HyClone) and 1% penicillin-streptomycin.

We maintained KYSE150 and KYSE510 cells as long-term laboratory stocks, originally obtained from a commercial source. The tissue microarray experiment was approved by the Ethics Committee of Shanghai Zhuoli Biotechnology Co., Ltd. (Approval No. SHLLS-BA-22101102; Validity Period: Long-term). We did not have STR authentication records for these legacy stocks. We did not perform mycoplasma testing. We used cells within a limited number of passages after thawing, although we did not systematically record exact passage numbers.

Generation of stable transfected cell lines

Lentiviral vectors encoding short hairpin RNAs (shRNAs) targeting NCAPH (sh-NCAPH-1 and sh-NCAPH-2) and a non-targeting control (sh-NC) were constructed and packaged in 293T cells. The lentiviral supernatants were then transduced into KYSE150 and KYSE510 cells. Following puromycin selection, stable NCAPH knockdown cell lines were established. The targeting sequences used were as follows—sh-NCAPH-1: 5'-CAGGAGTATTGACATTTCAGCTTCAAGAGAGCTGAAATGTCAATACTCCTG-3'; sh-NCAPH-2: 5'-GCAGCAGTGTGCAGAAGATCGTTCAAGAGACGATCTTCTGCACACTGCTGC-3'; and sh-NC: 5'-CCCTTCCTACAGATTTCAACTTTCAAGAGAAGTTGAAATCTGTAGGAAGGG-3'.

We infected cells at a multiplicity of infection (MOI) of 20 in the presence of polybrene (6 µg/mL). We then selected stable cells with puromycin (1.5 µg/mL) for 14 days and used pooled populations for subsequent experiments. We confirmed NCAPH knockdown by western blotting and qPCR and proceeded only with populations that showed >70% reduction.

IHC staining

Tissue samples were formalin-fixed, paraffin-embedded, and sectioned at 5 µm thickness. The following primary antibodies were used: anti‑NCAPH (1:100, Cat#10744-1-AP, Proteintech), anti‑β‑catenin (1:10,000, Cat#51067-2-AP, Proteintech), and anti‑Ki67 (1:300, Cat#27309-1-AP, Proteintech). Two independent pathologists scored slides blinded to clinical information; discrepancies were resolved by consensus. anti‑NCAPH (Proteintech, Cat#10744-1-AP), anti‑β‑catenin (Proteintech, Cat#51067-2-AP), and anti‑Ki67 (Proteintech, Cat#27309-1-AP). Antigen retrieval was performed in ethylenediaminetetraacetic acid (EDTA) buffer (pH 9.0) using microwave heating (medium heat 8 min, rest 8 min, medium‑low heat 7 min). Slides were scanned using a Pannoramic MIDI system. Detection chemistry was horseradish peroxidase (HRP) with 3,3'-diaminobenzidine (DAB).

We calculated the H-score as follows:

Hscore=pi×i

where i represents staining intensity (0, negative; 1, weak; 2, moderate; 3, strong) and Pi represents the percentage of positively stained cells at each intensity (0–100%). The final H-score ranges from 0 to 300. We defined high versus low NCAPH expression using an H-score cutoff of 40, which was pre-specified to dichotomize staining for downstream clinicopathological association analyses.

Cell proliferation assay

Transfected cells were seeded in 96-well plates at a density of 1×103 cells per well, with five replicates per condition, and incubated at 37 ℃ in a 5% carbon dioxide atmosphere. After confirming cell adhesion, cell proliferation was assessed on days 0, 2, 4, and 6 using the CCK-8 reagent (10 µL per well). Following 1.5 h incubation at 37 ℃, absorbance at 450 nm was measured using a microplate reader. Proliferation curves were plotted, and statistical analysis was performed.

Colony formation assay

Cells were seeded in 6-well plates at a density of 1,000 cells per well (in 2 mL of medium) and cultured for 14 days, with medium replaced every three days. Colonies were fixed with 4% paraformaldehyde, stained with crystal violet, and counted. Each experiment was conducted in triplicate.

Wound healing assay

To assess cell migration, we plated 8×105 cells per well in 6-well plates. After the cells reached confluence, we created a straight scratch in each well using a 200 µL pipette tip. We washed the wells with PBS, added serum-free medium, and incubated the cells for 0, 12, and 24 h. We imaged wound closure at each time point and quantified migration as the percentage of gap closure. We independently repeated each wound-healing experiment at least three times. We analyzed three wells per group and acquired images from one field per well for quantification. Because scratch widths may vary slightly across wells, we normalized measurements to the 0 h baseline for each well and calculated the percentage of gap closure for comparisons.

Transwell migration assay and Matrigel invasion assay

For migration assays, we seeded 1×105 ESCC cells in 200 µL serum-free medium into 24-well Transwell inserts and added 600 µL complete medium containing 20% FBS to the lower chamber as a chemoattractant. After 48 h at 37 ℃, we removed non-migrated cells from the upper surface of the membrane, fixed the migrated cells on the underside with 4% PFA, stained them with 0.5% crystal violet, and captured images. For invasion assays, we pre-coated each insert with 100 µL of Matrigel (diluted 1:9 in serum-free medium) and allowed it to gel at 37 ℃ for four hours. We then processed cells in the same manner as in the migration assay. We independently repeated each Transwell experiment at least three times, analyzed three inserts per group, and counted migrated/invaded cells in three random fields per insert.

RNA extraction and quantitative PCR (qPCR) analysis

We isolated total RNA from ESCC cells using TriQuick Reagent (Solarbio, China) according to the manufacturer’s instructions. We synthesized complementary DNA (cDNA) using the HiScript II Q RT SuperMix kit (Vazyme, China). We performed qPCR with ChamQ SYBR qPCR Master Mix (Vazyme) on a QuantStudio 5 system (Applied Biosystems). We conducted all experiments with three independent biological replicates (n=3). We used ACTB (β-actin) as the internal reference gene. We normalized cycle threshold (Ct) values to ACTB to calculate ΔCt (Ct_target − Ct_ACTB). We calculated relative messenger RNA (mRNA) expression using the 2−ΔΔCt method, with the sh-NC group as the calibrator, and reported results as fold change relative to sh-NC. Primer sequences appear in Table 1.

Table 1

Primer sets used for qPCR

Gene Primer sequence (5' to 3')
Human ACTIN F TCCTTCCTGGGCATGGAGT
Human ACTIN R AGCACTGTGTTGGCGTACAG
Human CCND1 F GAGGCGGAGGAGAACAAACA
Human CCND1 R GGAGGGCGGATTGGAAATGA
Human NCAPH F CCTCAATGTCTCCGAAGCAGATC
Human NCAPH R TGTAGTCCTGGCAGTGGAGAGT
Human WNT4 F GCTGGAGAAGTGCGGCTGTGA
Human WNT4 R CCACAAACGACTGTGAGAAGGC
Human B-Catenin F CACAAGCAGAGTGCTGAAGGTG
Human B-Catenin R GATTCCTGAGAGTCCAAAGACAG

qPCR, quantitative polymerase chain reaction.

Western blotting

Protein extracts from KYSE150 and KYSE510 cells were separated on 10–15% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS-PAGE) gels and transferred to polyvinylidene fluoride (PVDF) membranes. After blocking with 5% skim milk [2 h, room temperature (RT)], the membranes were carefully cut according to the predicted molecular weights of the housekeeping and target proteins, and the separated membrane strips were then individually probed with their respective primary antibodies. Membranes were incubated overnight at 4 °C with primary antibodies against β-catenin (1:50,000, Proteintech), β-actin (1:40,000, Proteintech), NCAPH (1:2,000, Proteintech), and CCND1 (1:2,000, Proteintech). After washing, membranes were incubated for one hour at 37 ℃ with HRP-conjugated secondary antibodies (1:10,000, Proteintech). Protein bands were visualized using ECL substrate (Biosharp) and imaged with the Bio-Rad ChemiDoc™ MP Imaging System (CA, USA).

ELISA

The concentration of WNT4 protein in the culture supernatants of ESCC cells was quantified using a human WNT4 ELISA kit (Buisaigi Biotechnology, China) following the manufacturer’s protocol.

RNA-seq and bioinformatic analysis

shNC vs. shNCAPH (both sh‑NCAPH‑1 and sh‑NCAPH‑2; n=2 per group). Total RNA was extracted using TRIzol reagent (Thermo Fisher, Cat#15596026) and assessed for integrity [RNA integrity number (RIN) ≥7]. Libraries were prepared using the VAHTS Universal V6 RNA‑seq Library Prep Kit for Illumina and sequenced using PE150 on an Illumina NovaSeq 6000, yielding ≥40 million clean reads per sample. Reads were aligned to GRCh38/hg38 using HISAT2. Differential expression was analyzed with DESeq2 using thresholds |log2 fold change (FC)| ≥0.585 and false discovery rate (FDR) <0.05. Enrichment analyses [Gene Ontology/Kyoto Encyclopedia of Genes and Genomes (GO/KEGG)] were conducted with clusterProfiler.

Tumor xenograft assay in vivo

Five-week-old male nude mice were obtained from GemPharmatech LLC (Nanjing, China). Stably transfected ESCC cells were injected subcutaneously into the lateral flanks of mice (n=6 per group). Tumor size was measured every 3 days using digital calipers, and tumor volume was calculated as V = (length × width2)/2, where length is the longest diameter and width is the shortest diameter. At the endpoint, mice were euthanized under deep anesthesia followed by cervical dislocation. The absence of heartbeat and respiration confirmed death. Subcutaneous tumors were excised, weighed, and processed for immunohistochemistry. All procedures were approved by the Experimental Animal Welfare and Ethics Committee of Hefei National Comprehensive Science Center Institute of General Health (Approval No. IHM-AP-2025-013; validity period: February 11, 2025–February 11, 2028), in compliance with the national or institutional guidelines for the care and use of animals, and the maximum permitted tumor volume did not exceed 2,000 mm3.

We housed mice under specific pathogen-free (SPF) conditions (22±1 °C, 50%±10% humidity, 12-h light/dark cycle) with ad libitum access to food and water. We randomly assigned animals to groups, and two investigators measured tumor size; we did not apply blinding. We injected KYSE150 cells (1×107 cells in 100 µL PBS) subcutaneously into the flank and did not use Matrigel. We defined humane endpoints as tumor ulceration, impaired mobility, or tumor volume exceeding 2,000 mm3. We did not use body weight loss as a prespecified endpoint and did not administer analgesia or anesthesia. We pre-specified no exclusion criteria. The primary outcome was tumor volume over time, and secondary outcomes included tumor weight and IHC markers (e.g., Ki67 and β-catenin).

Statistical analysis

We present data as mean ± standard error of the mean (SEM) from at least three independent experiments unless otherwise stated. We used an unpaired two-tailed Student’s t-test for two-group comparisons and one-way analysis of variance (ANOVA) followed by Tukey’s post hoc test for comparisons among ≥3 groups. We analyzed categorical variables using the Chi-squared test or Fisher’s exact test, as appropriate. We performed statistical analyses in SPSS 20.0 (IBM) and GraphPad Prism 9.0. We considered P<0.05 statistically significant (*, P<0.05; **, P<0.01; ***, P<0.001).

For in vitro assays, “n” denotes independent biological replicates, and we averaged technical replicates within each experiment. For xenograft experiments, “n” denotes individual mice. We did not exclude any data unless we pre-specified the criteria in the Methods. We did not formally test for normality or homogeneity of variance. We applied multiple-comparison adjustments as stated (e.g., Tukey). We used two-sided tests unless otherwise specified, and we report P values in the figures/legends where appropriate.


Results

NCAPH is upregulated in ESCC and predicts poor prognosis

Analysis of publicly available datasets, including TCGA and GEO (GSE23400, GSE20347, GSE38129, GSE45670), revealed that NCAPH expression levels were significantly elevated in ESCC tissues compared to adjacent normal tissues (Figure 1A-1E). GEPIA2 analysis also evaluated NCAPH expression in the esophageal cancer cohort (ESCA) (Figure 1F). As GEPIA2 integrates TCGA tumors with Genotype-Tissue Expression (GTEx) normal tissues and the ESCA cohort includes mixed histologies, the absolute tumor-normal direction may differ across platforms; therefore, we relied on multiple GEO cohorts and TCGA to establish consistent NCAPH upregulation in ESCC. Furthermore, survival analysis of the GSE53622 dataset using the Hiplot platform indicated that high NCAPH expression correlated with significantly reduced overall survival compared with low NCAPH expression. Single-cell analysis further characterized the cell-type-specific expression of NCAPH and is presented in Figure 2.

Figure 1 NCAPH exhibits elevated expression levels in ESCC and correlates with poor clinical outcomes. (A-D) NCAPH expression in ESCC tumors and normal esophageal tissues from GEO datasets: GSE20347 (n=17 tumor vs. n=17 normal), GSE23400 (n=53 tumor vs. n=53 normal), and GSE38129 (n=30 tumor vs. n=30 normal). (D) GSE45670 includes 28 ESCC tumors and 10 normal esophageal epithelia. (E) TCGA-ESCA cohort (tumor n=161, normal n=11). (F) GEPIA2 analysis of NCAPH expression in the ESCA cohort (TCGA tumor vs. GTEx normal). ***, P<0.001. ESCC, esophageal squamous cell carcinoma; GEO, Gene Expression Omnibus; GTEx, Genotype-Tissue Expression; mRNA, messenger RNA; NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; TCGA-ESCA, The Cancer Genome Atlas-Esophageal Carcinoma.
Figure 2 Comparative scRNA-seq analysis of NCAPH expression in normal esophageal versus esophageal squamous cell carcinoma tissues. (A) Dot plot illustrating the differential expression of key stemness-associated genes across various cell subtypes in normal esophageal tissue. (B) Dot plot depicting variable expression patterns of core stemness-related genes among different tumor cell subtypes. (C) UMAP visualization representing the distribution of distinct cell populations in normal esophageal tissue. (D) UMAP projection of NCAPH expression across diverse cell types in normal esophageal tissue. (E) Violin plot detailing the expression levels of NCAPH among various cell types in normal esophageal tissue. (F) UMAP visualization illustrating the composition and distribution of cellular subtypes in esophageal squamous cell carcinoma. (G) UMAP projection highlighting NCAPH expression across different cell types within esophageal squamous cell carcinoma. (H) Violin plot analyzing the expression distribution of NCAPH among diverse cellular populations in esophageal squamous cell carcinoma. (D) and (G) were plotted using the same color scale (min/max) to facilitate comparison. NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; scRNA-seq, single-cell RNA sequencing; UMAP, Uniform Manifold Approximation and Projection.

Analysis of NCAPH cellular distribution in normal esophageal tissue and esophageal cancer tissue via single-cell RNA-seq (scRNA-seq)

This study utilized publicly available scRNA-seq data and corresponding clinical data from the GEO database (accession number: GSE196756). The dataset was generated using the 10× Genomics platform and includes samples from three treatment-naïve patients with ESCC and three matched adjacent normal tissues. Bioinformatics analysis was performed in R. Cell types were determined using a custom marker gene list and visualized in dot plots. Clusters were re-annotated according to expression profile characteristics into distinct cell subtypes, including “Monocyte”, “Fibroblast”, “T cell”, “Epithelial cell”, “Mast cell”, and “B cell”. The annotated cell distributions were displayed in low-dimensional embedding maps such as UMAP or t-distributed stochastic neighbor embedding (t-SNE) (Figure 2A,2B). For NCAPH, expression distribution and intensity differences across cell subtypes were visualized using FeaturePlot and VlnPlot. The results demonstrated that in normal esophageal tissue, NCAPH expression was predominantly localized to B cells (Figure 2C-2E). In contrast, in ESCC tissue, NCAPH was highly expressed mainly in epithelial cells (Figure 2F-2H).

Association between NCAPH expression and clinicopathological parameters in ESCC

To investigate the protein expression of NCAPH in ESCC, we performed IHC staining on an ESCC tissue microarray (Figure 3A). Correlation analysis indicated a statistically significant positive association between elevated NCAPH expression and higher pathological grade (P=0.047). However, no significant associations were observed with patient age (P=0.83), gender (P=0.32), tumor stage (P=0.92), nodal status (P=0.55), presence of metastasis (P=0.90), or American Joint Committee on Cancer (AJCC) stage (P=0.85) (Figure 3B). IHC analysis revealed significantly higher NCAPH expression in ESCC tumor tissues relative to matched adjacent normal tissues (Figure 3C,3D).

Figure 3 Elevated NCAPH levels in ESCC are associated with clinicopathological features. (A) Representative H&E and IHC staining of NCAPH in ESCC and matched adjacent normal tissues (scale bar). (B) Association between NCAPH expression (H-score <40 vs. ≥40) and clinicopathological parameters in the ESCC cohort. (C) Summary of NCAPH IHC expression in tumor versus adjacent tissues (n=38). (D) Paired comparison of NCAPH H-scores between tumor and adjacent tissues. *, P<0.05. H-score calculation and cutoff definition are described in the “Methods” section—IHC staining. AJCC, American Joint Committee on Cancer; ESCC, esophageal squamous cell carcinoma; H&E, hematoxylin and eosin; IHC, immunohistochemical; M, metastasis; N, node; NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; T, tumor.

NCAPH knockdown inhibits the malignant characteristics of ESCC cells

Stable NCAPH knockdown was achieved in KYSE150 and KYSE510 cell lines using two independent shRNAs (sh-NCAPH-1 and sh-NCAPH-2). Western blotting confirmed efficient NCAPH depletion in both cell lines, and these two shRNAs were used for subsequent experiments (Figure 4A). Therefore, sh-NCAPH-1 and sh-NCAPH-2 groups were selected for subsequent analyses. CCK-8 and colony formation assays confirmed that NCAPH silencing significantly reduced cell proliferation and clonogenic capacity in both KYSE150 and KYSE510 cell lines compared to controls (Figure 4B,4C). Furthermore, wound-healing and transwell migration assays revealed a significant reduction in migratory capacity, and Matrigel invasion assays demonstrated a significant decrease in invasive capacity in NCAPH-depleted cells compared to controls (Figure 4D,4E).

Figure 4 Knockdown of NCAPH suppresses ESCC progression in vitro. (A) Western blot analysis was performed to assess NCAPH expression levels in ESCC cells transfected with specific shRNAs. (B) Proliferation rates of the transfected cells were evaluated using growth curve assays. (C) Colony formation assays were conducted, with representative images and quantitative results displayed (magnification × stained). (D) Cell migratory capacity was examined using wound-healing assays. Wound closure was normalized to the 0 h width for each well and expressed as % gap closure (magnification ×). (E) Transwell assays were used to measure cell migration and invasion (magnification × stained). *, P<0.05; **, P<0.01; ***, P<0.001. ESCC, esophageal squamous cell carcinoma; NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; OD, optical density; shNCAPH, short hairpin RNA targeting NCAPH; shRNAs, short hairpin RNAs.

NCAPH knockdown inhibits Wnt/β-catenin signaling pathway

RNA-seq results are shown in Figure 5A-5D (volcano plots and GO/KEGG enrichment). To explore potential mechanisms downstream of NCAPH, RNA-seq was performed in KYSE150 and KYSE510 cells transfected with sh-NC or sh-NCAPH. Pathway enrichment suggested involvement of Wnt/β-catenin-related signaling. We therefore examined key components of this pathway by qPCR (Figure 5E), western blotting (Figure 5F), and ELISA measurement of secreted WNT4 (Figure 5G). NCAPH knockdown reduced β-catenin and its downstream target CCND1, along with decreased WNT4, indicating that NCAPH promotes ESCC progression at least in part by activating Wnt/β-catenin signaling.

Figure 5 Wnt/β-catenin signaling is inhibited by NCAPH knockdown. (A) Volcano plot of RNA-seq data for KYSE150 cells. (B) GO pathways that were markedly depleted in KYSE150 cells with NCAPH knockdown. (C) Volcano plot of RNA-seq data for KYSE510 cells. (D) KEGG pathways that were markedly depleted in KYSE510 cells with NCAPH knockdown. (E) Detection of NCAPH, WNT4, β-catenin, and CCND1 mRNA levels in transfected KYSE150 and KYSE510 cells by qPCR. (F) Western blot was used to detect the protein levels of NCAPH, β-catenin, and CCND1 in transfected KYSE150 and KYSE510 cells. (G) The protein level of WNT4 in the supernatant of transfected KYSE150 and KYSE510 cells was measured by ELISA. *, P<0.05; **, P<0.01; ***, P<0.001. ELISA, enzyme-linked immunosorbent assay; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; mRNA, messenger RNA; NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; qPCR, quantitative polymerase chain reaction; RNA-seq, RNA sequencing; shNCAPH, short hairpin RNA targeting NCAPH.

Downregulation of NCAPH reduces tumor growth in vivo

To evaluate the effect of NCAPH knockdown on tumorigenesis in vivo, KYSE150 cells stably transfected with sh-NC, sh-NCAPH-1, or sh-NCAPH-2 were subcutaneously injected into nude mice. Tumor growth was monitored every 3 days. Mice injected with NCAPH knockdown cells exhibited significantly reduced tumor volume and weight compared to controls (Figure 6A-6C). IHC analysis of tumor sections revealed significantly decreased expression of NCAPH, β-catenin, and Ki67 in the knockdown groups, supporting the role of NCAPH in promoting tumor growth via the Wnt/β-catenin axis (Figure 6D).

Figure 6 Knockdown of NCAPH inhibits ESCC progression in vivo. (A) Representative tumor images per group. (B) KYSE150 xenograft tumor growth curves (mean ± SEM, n=6). (C) Tumor weights (n=6 per group). (D) IHC analysis of NCAPH, β-catenin, and Ki67 in tumors (n=6 mice/group); *, P<0.05; ***, P<0.001. ESCC, esophageal squamous cell carcinoma; IHC, immunohistochemical; NCAPH, non-structural maintenance of chromosome condensin I complex subunit H; SEM, standard error of the mean; shNCAPH, short hairpin RNA targeting NCAPH.

Discussion

Previous studies have implicated NCAPH as an oncogenic factor in several malignancies; however, its cell-type-specific distribution and mechanistic role in ESCC have remained insufficiently characterized. In this work, we combined bulk transcriptomic cohorts, single-cell mapping, clinical IHC validation, and both in vitro and in vivo functional assays to establish a coherent evidence chain supporting NCAPH as a driver of ESCC progression. Our findings further suggest that NCAPH may promote malignant phenotypes through activation of the Wnt/β-catenin axis, providing a rationale for targeting this pathway in NCAPH-high ESCC. ESCC remains one of the most lethal malignancies globally, with clinical management still heavily dependent upon surgical resection and radiotherapy. Due to its typically asymptomatic nature in early stages, most ESCC cases are diagnosed at advanced stages. Conventional treatments, including chemotherapy and radiation, often have limited efficacy and are associated with significant adverse effects. In this sense, identifying novel molecular targets is essential to improve prognosis and therapeutic efficacy. Advances in high-throughput sequencing and bioinformatics have facilitated the discovery of new biomarkers and potential therapeutic targets for malignancies (36,37).

NCAPH plays a key role in chromosomal condensation and segregation by forming a pentameric structure with the SMC2 and SMC4 core proteins (38,39). Increasing evidence suggests that NCAPH is aberrantly expressed in various cancers. Transcriptionally, NCAPH is regulated by MYBL2 (23), FOXP3 (40), GATA3 (41), and OTC1 (14). Functionally, NCAPH has been implicated in modulating several oncogenic pathways, including β-catenin/PD-L1 (12), PI3K/AKT/SGK3 (25), MEK/ERK (42), AURKB/AKT/mTOR (43), PI3K/PDK1/AKT (41), and Chk1/Chk2 (13), therefore affecting key hallmarks of cancer such as proliferation, apoptosis resistance, metastasis, therapy resistance, and immune evasion. Additional roles in glycolysis (29) and DNA repair (40) further underline NCAPH’s multifaceted involvement in tumorigenesis. Elevated NCAPH expression correlates with poor prognosis across several tumor types.

The Wnt/β-catenin signaling pathway is critical for epithelial cell proliferation and represents a promising therapeutic target in cancers, including ESCC (41). Aberrant β-catenin activity contributes to tumor growth, resistance to apoptosis, and epithelial-mesenchymal transition (EMT), driving metastatic progression and treatment failure in esophageal carcinoma (42-45). Experimental silencing of NCAPH using genetic interference techniques significantly reduces Wnt/β-catenin-responsive gene activation, thereby impairing pathway functionality.

To our knowledge, no study has investigated NCAPH in the context of ESCC. Integrating five ESCC datasets, including TCGA, revealed significantly elevated NCAPH expression in ESCC tissues relative to adjacent non-tumorous tissues. IHC staining of ESCC tissue microarrays confirmed this finding. Functional experiments revealed that NCAPH knockdown suppressed proliferation, migration, and invasion in vitro, and significantly reduced tumor growth in vivo. Transcriptomic profiling indicated that NCAPH knockdown impairs the Wnt/β-catenin signaling cascade, with concordant reductions in β-catenin, CCND1, and WNT4 expression confirmed by Western blot, qPCR, and ELISA. These findings suggest that NCAPH may exert oncogenic effects in ESCC by activating Wnt/β-catenin signaling.


Conclusions

This study comprehensively investigated NCAPH expression in ESCC and paired adjacent normal tissues through combined bioinformatics analysis, tissue microarray validation, and functional experiments. Functional studies and RNA-seq analysis demonstrate that NCAPH is upregulated in ESCC and facilitates tumor progression via the Wnt/β-catenin pathway. Targeted inhibition of NCAPH reduces tumor aggressiveness, suggesting that NCAPH represents a promising molecular target for therapeutic intervention in ESCC.


Acknowledgments

None.


Footnote

Reporting Checklist: The authors have completed the MDAR and ARRIVE reporting checklists. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1060/rc

Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1060/dss

Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1060/prf

Funding: This study was supported by the Natural Research Project of Higher Education of Anhui Province (grant No. 2023AH050682).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2025-1-1060/coif). All authors report that this study was supported by the Natural Research Project of Higher Education of Anhui Province (Grant No. 2023AH050682). The authors have no other conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. This study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. All animal experiments were approved by the Experimental Animal Welfare and Ethics Committee of Hefei National Comprehensive Science Center Institute of General Health (Approval No. IHM-AP-2025-013; Validity Period: February 11, 2025 – February 11, 2028), in compliance with the national or institutional guidelines for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.


References

  1. Han B, Zheng R, Zeng H, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent 2024;4:47-53. [Crossref] [PubMed]
  2. He H, Chen N, Hou Y, et al. Trends in the incidence and survival of patients with esophageal cancer: A SEER database analysis. Thorac Cancer 2020;11:1121-8. [Crossref] [PubMed]
  3. Zhang Y, Zhang H, Sun X, et al. Nucleic acid aptamer controls mycoplasma infection for inhibiting the malignancy of esophageal squamous cell carcinoma. Mol Ther 2022;30:2224-41. [Crossref] [PubMed]
  4. Li W, Yang Y, Huang L, et al. The TDP-43/TP63 Positive Feedback Circuit Promotes Esophageal Squamous Cell Carcinoma Progression. Adv Sci (Weinh) 2024;11:e2402913. [Crossref] [PubMed]
  5. Morgan E, Soerjomataram I, Rumgay H, et al. The Global Landscape of Esophageal Squamous Cell Carcinoma and Esophageal Adenocarcinoma Incidence and Mortality in 2020 and Projections to 2040: New Estimates From GLOBOCAN 2020. Gastroenterology 2022;163:649-658.e2. [Crossref] [PubMed]
  6. Chmielewski PP, Strzelec B, Rudno-Rudzińska J. Wnt Signaling and Circular RNAs in Esophageal and Gastric Cancers: Opportunities for Early Detection and Targeted Therapy. J Clin Med 2025;14:4805. [Crossref] [PubMed]
  7. Wu X, Que H, Li Q, et al. Wnt/β-catenin mediated signaling pathways in cancer: recent advances and applications in cancer therapy. Mol Cancer 2025;24:171. [Crossref]
  8. Wang M, Robertson D, Zou J, et al. Molecular mechanism targeting condensin for chromosome condensation. EMBO J 2025;44:705-35. [Crossref] [PubMed]
  9. Pastic A, Nosella ML, Kochhar A, et al. Chromosome compaction is triggered by an autonomous DNA-binding module within condensin. Cell Rep 2024;43:114419. [Crossref] [PubMed]
  10. Lai SK, Wong CH, Lee YP, et al. Caspase-3-mediated degradation of condensin Cap-H regulates mitotic cell death. Cell Death Differ 2011;18:996-1004. [Crossref] [PubMed]
  11. Cutts EE, Tetiker D, Kim E, et al. Molecular mechanism of condensin I activation by KIF4A. EMBO J 2025;44:682-704. [Crossref] [PubMed]
  12. Choi EH, Kim KP. Cohesin and condensin regulate chromosome topology and play an essential role in maintaining pluripotency in embryonic stem cells. Sci Rep 2025;15:9918. [Crossref] [PubMed]
  13. Kim JH, Youn Y, Kim KT, et al. Non-SMC condensin I complex subunit H mediates mature chromosome condensation and DNA damage in pancreatic cancer cells. Sci Rep 2019;9:17889. [Crossref] [PubMed]
  14. Liu C, Han X, Zhang S, et al. The role of NCAPH in cancer treatment. Cell Signal 2024;121:111262. [Crossref] [PubMed]
  15. Hirota T, Gerlich D, Koch B, et al. Distinct functions of condensin I and II in mitotic chromosome assembly. J Cell Sci 2004;117:6435-45. [Crossref] [PubMed]
  16. Kagami Y, Yoshida K. The functional role for condensin in the regulation of chromosomal organization during the cell cycle. Cell Mol Life Sci 2016;73:4591-8. [Crossref] [PubMed]
  17. Sun Y, Wang X, Wen H, et al. Expression and Clinical Significance of the NCAPH, AGGF1, and FOXC2 Proteins in Serous Ovarian Cancer. Cancer Manag Res 2021;13:7253-62. [Crossref] [PubMed]
  18. Olah C, Mairinger F, Wessolly M, et al. Enhancing risk stratification models in localized prostate cancer by novel validated tissue biomarkers. Prostate Cancer Prostatic Dis 2025;28:773-81. [Crossref] [PubMed]
  19. Ogura T, Azuma K, Sato J, et al. OCT1 Is a Poor Prognostic Factor for Breast Cancer Patients and Promotes Cell Proliferation via Inducing NCAPH. Int J Mol Sci 2021;22:11505. [Crossref] [PubMed]
  20. Lu H, Shi C, Wang S, et al. Identification of NCAPH as a biomarker for prognosis of breast cancer. Mol Biol Rep 2020;47:7831-42. [Crossref] [PubMed]
  21. Zhang T, Li P, Guo W, et al. NCAPH promotes proliferation as well as motility of breast cancer cells by activating the PI3K/AKT pathway. Physiol Int 2022;109:334-47. [Crossref] [PubMed]
  22. Xiong Q, Jiang L, Liu K, et al. miR-133b targets NCAPH to promote β-catenin degradation and reduce cancer stem cell maintenance in non-small cell lung cancer. Signal Transduct Target Ther 2021;6:252. [Crossref] [PubMed]
  23. Xiong YC, Wang J, Cheng Y, et al. Overexpression of MYBL2 promotes proliferation and migration of non-small-cell lung cancer via upregulating NCAPH. Mol Cell Biochem 2020;468:185-93. [Crossref] [PubMed]
  24. Kim B, Kim SW, Lim JY, et al. NCAPH Is Required for Proliferation, Migration and Invasion of Non-small-cell Lung Cancer Cells. Anticancer Res 2020;40:3239-46. [Crossref] [PubMed]
  25. Wang M, Qiao X, Cooper T, et al. HPV E7-mediated NCAPH ectopic expression regulates the carcinogenesis of cervical carcinoma via PI3K/AKT/SGK pathway. Cell Death Dis 2020;11:1049. [Crossref] [PubMed]
  26. Liu L, Yin P, Yang R, et al. Integrated bioinformatics combined with machine learning to analyze shared biomarkers and pathways in psoriasis and cervical squamous cell carcinoma. Front Immunol 2024;15:1351908. [Crossref] [PubMed]
  27. Zhao Y, He Y, Xiao Z, et al. circEIF3I Promotes Colorectal Cancer Metastasis by Regulating the miR-328-3p/NCAPH Axis. Mol Carcinog 2025;64:450-62. [Crossref] [PubMed]
  28. Yin L, Jiang LP, Shen QS, et al. NCAPH plays important roles in human colon cancer. Cell Death Dis 2017;8:e2680. [Crossref] [PubMed]
  29. Lei Y, Wang D, Chen W, et al. FOXM1/NCAPH activates glycolysis to promote colon adenocarcinoma stemness and 5-FU resistance. Anticancer Drugs 2023;34:929-38. [Crossref] [PubMed]
  30. Huang P, Zhao H, Sun R, et al. MiR-1976/NCAPH/P65 axis inhibits the malignant phenotypes of lung adenocarcinoma. Sci Rep 2024;14:11211. [Crossref] [PubMed]
  31. Li B, Xiao Q, Shan L, et al. NCAPH promotes cell proliferation and inhibits cell apoptosis of bladder cancer cells through MEK/ERK signaling pathway. Cell Cycle 2022;21:427-38. [Crossref] [PubMed]
  32. Zhang Y, Shi C, Zhou Y, et al. H2BC9 lactylation modulates esophageal squamous cell carcinoma progression via the Wnt/β-catenin signaling pathway. J Transl Med 2025;23:1085. [Crossref] [PubMed]
  33. Lin C, Wu Y, Qian Y, et al. SATB2 promotes radiation resistance of esophageal squamous cell carcinoma by regulating epithelial-to-mesenchymal transition via the Wnt/β-catenin pathway. Front Oncol 2025;15:1543426. [Crossref] [PubMed]
  34. Niu H, Wei H, Zhou X, et al. BRD4 Induces Esophageal Squamous Cell Carcinoma Progression via the Wnt/β-catenin Pathway. Biochem Genet 2026;64:446-67. [Crossref] [PubMed]
  35. Li SJ, Liang ZR, Liu ZC, et al. LIMK1 as a Novel Kinase of β-Catenin Promotes Esophageal Cancer Metastasis by Cooperating With CDK5. Adv Sci (Weinh) 2025;12:e03223. [Crossref] [PubMed]
  36. Yang YM, Hong P, Xu WW, et al. Advances in targeted therapy for esophageal cancer. Signal Transduct Target Ther 2020;5:229. [Crossref] [PubMed]
  37. Thrift AP. Global burden and epidemiology of Barrett oesophagus and oesophageal cancer. Nat Rev Gastroenterol Hepatol 2021;18:432-43. [Crossref] [PubMed]
  38. Tang L, Chen Y, Peng X, et al. Identification and Validation of Potential Pathogenic Genes and Prognostic Markers in ESCC by Integrated Bioinformatics Analysis. Front Genet 2020;11:521004. [Crossref] [PubMed]
  39. Wang X, Han J, Liu Y, et al. miR-17-5p and miR-4443 Promote Esophageal Squamous Cell Carcinoma Development by Targeting TIMP2. Front Oncol 2021;11:605894. [Crossref] [PubMed]
  40. Saitoh N, Goldberg I, Earnshaw WC. The SMC proteins and the coming of age of the chromosome scaffold hypothesis. Bioessays 1995;17:759-66. [Crossref] [PubMed]
  41. Schmiesing JA, Ball AR Jr, Gregson HC, et al. Identification of two distinct human SMC protein complexes involved in mitotic chromosome dynamics. Proc Natl Acad Sci U S A 1998;95:12906-11. [Crossref] [PubMed]
  42. Wang Y, Li JQ, Yang ZL, et al. NCAPH regulates gastric cancer progression through DNA damage response. Neoplasma 2022;69:283-91. [Crossref] [PubMed]
  43. Zhan T, Rindtorff N, Boutros M. Wnt signaling in cancer. Oncogene 2017;36:1461-73. [Crossref] [PubMed]
  44. Lin DC, Zhang Y, Pan QJ, et al. PLK1 Is transcriptionally activated by NF-κB during cell detachment and enhances anoikis resistance through inhibiting β-catenin degradation in esophageal squamous cell carcinoma. Clin Cancer Res 2011;17:4285-95. [Crossref] [PubMed]
  45. Han L, Dai S, Li Z, et al. Combination of the natural compound Periplocin and TRAIL induce esophageal squamous cell carcinoma apoptosis in vitro and in vivo: Implication in anticancer therapy. J Exp Clin Cancer Res 2019;38:501. [Crossref] [PubMed]
Cite this article as: Xu Y, Guo A, Yang J, Zhang M, Yuan B. Non-structural maintenance of chromosome condensin I complex subunit H knockdown suppresses malignant progression of esophageal squamous cell carcinoma via the Wnt/β-catenin signaling pathway. J Gastrointest Oncol 2026;17(4):213. doi: 10.21037/jgo-2025-1-1060

Download Citation