Sphingosine-1-phosphate induces angiogenesis via the activating STAT3 signaling pathway to drive colorectal cancer progression

Introduction

Colorectal cancer (CRC) is one of the most common malignant gastrointestinal tumors worldwide, ranks third in incidence and second in mortality among all malignant tumors (1,2), and remains among the most lethal human malignancies. Although the implementation of early screening programs in high-prevalence regions has reduced the incidence of CRC, overall patient survival remains unsatisfactory (3). Mortality is particularly high in patients with advanced CRC and severely compromises quality of life, primarily due to the high invasiveness and metastatic potential of the disease (4). Therefore, elucidating the mechanisms underlying CRC initiation, progression, and metastasis is needed to identify potential therapeutic targets.

Sphingosine-1-phosphate (S1P) is a key bioactive lipid in the human body and is distributed in the human brain, lung, liver, colonic epithelium, red blood cells, and platelets, and other tissues (5-7). As a metabolite of sphingolipids, S1P is phosphorylated by sphingosine kinase 1/2 (SPHK1/2) and released into the extracellular space, where it initiates signal transduction via G protein-coupled receptors on the cell surface (8,9). As a critical mediator of sphingolipid metabolism across a number of malignancies, S1P regulates cancer cell proliferation, invasive capacity, angiogenesis, and tumor immune evasion (10). Studies have demonstrated that the pharmacological blockade of the SPHK1-S1P axis in triple-negative breast cancer suppresses cell proliferation and migration, thereby restraining tumor outgrowth and lymphatic metastasis (11). A substantial body of in vitro and in vivo evidence has confirmed the presence of an S1P-YAP signaling axis in lymphoma cells; moreover, it has been found that S1P signal-mediated macrophage polarization remodels the microenvironment into an immunosuppressive state and accelerates lymphomagenesis (12). Acting as a paracrine factor secreted by melanoma cells, S1P remodels the keratinocyte transcriptome, weakens intercellular adhesion, and ultimately enhances the invasive potential of tumors (13). Research combining network pharmacology and clinical trial methodologies identified S1P signaling as a primary driver of imatinib resistance independent of BCR-ABL1 activity (14). Moreover, sustained activation of the SPHK1-S1P cascade sustains prostate cancer cell survival, whereas suppression of S1P biosynthesis restores enzalutamide sensitivity and markedly curbs the growth of drug-resistant tumors (15).

Angiogenesis is a prerequisite for the emergence of core malignant phenotypes, including solid tumor growth and distant metastasis (16). Tumor lesions frequently initiate neovascularization to sustain unrestrained tumor expansion and metastatic spread (17). Therapeutic targeting of the SPHK1-S1P axis may disrupt glycolytic metabolism to hinder hepatocellular carcinoma progression and tumor angiogenesis (18). Meanwhile, blockade of the SPHK1-S1P-S1PR2 signaling cascade mitigates angiogenesis and suppresses pituitary adenoma progression (19). However, the exact molecular mechanisms by which S1P promotes the metastatic progression of CRC remain poorly characterized.

Signal transducer and activator of transcription 3 (STAT3) is a key intracellular signaling transducer governing angiogenesis and malignant progression (20). Vascular endothelial growth factor A (VEGFA) has been well established as a canonical downstream transcriptional target of activated STAT3 signaling (21,22). Hyperactivated STAT3 signaling is tightly linked to metastatic dissemination in a number of cancers, including hepatocellular carcinoma (23) and gastric cancer (24). However, whether S1P modulates CRC progression through STAT3/VEGFA-dependent angiogenic signaling has not yet been clarified. In our study, we systematically examined the oncogenic effects of S1P on CRC progression, its transcriptional regulation of STAT3/VEGFA signaling, and its functional impact on tumor angiogenesis. The aim of this study was to delineate the oncogenic role of S1P in CRC and to determine whether S1P may serve as a biomarker for clinical diagnosis and prognostic stratification among patients with CRC. We present this article in accordance with the ARRIVE and MDAR reporting checklists (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2026-0448/rc).

Methods

Clinical patient samples

A total of 40 patients with CRC, including 25 males and 15 females (aged 30–70 years), who underwent surgical resection in the Department of Gastrointestinal Surgery at The First Affiliated Hospital of Bengbu Medical University from January to December 2024, were enrolled in the study. CRC tissues and matched noncancerous tissue samples were collected. The clinical characteristics of the patients, including gender, age, tumor size, and clinical stage, were retrieved from medical records (Table 1). The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Bengbu Medical University [Bengbu, China; Approval No. (2023)311; May 26, 2023]. Written informed consent was obtained from each individual according to the Ethics Committee’s terms. All procedures were performed in compliance with relevant institutional guidelines and governmental regulations. This study was not registered in a clinical trial registry.

Main reagents and supplies

S1P was purchased from Cayman Chemical (Cat. No. 62570; Ann Arbor, MI, USA). Fingolimod (FTY720) (Cat. No. HY-11063) and 2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide (TPCA) (Cat. No. HY-10074) were obtained from MedChemExpress (MCE; Monmouth Junction, NJ, USA). Enzyme-linked immunosorbent assay (ELISA) kits (Cat. No. JM-10781R2-S1P/JM-11362R1-CD31) were purchased from Jiangsu Jingmei Biotechnology Co., Ltd. (Yancheng, China). Dulbecco’s modified Eagle’s medium (DMEM), trypsin, and fetal bovine serum (FBS) were supplied by Gibco (Thermo Fisher Scientific, Waltham, MA, USA). Mouse monoclonal antibodies against STAT3 (Cat. No. 60199-1-Ig), phosphorylated STAT3 (p-STAT3) (Cat. No. 60479-1-Ig), and VEGFA (Cat. No. 66828-1-Ig) were purchased from Proteintech Group (Wuhan, China), while rabbit polyclonal antibodies against GAPDH (Cat. No. ab128915), MKI67 (Cat. No. ab16667), and CD31 (Cat. No. ab182981) were obtained from Abcam (Cambridge, UK). Primers were synthesized by Sangon Biotech Co., Ltd (Shanghai, China). Lentiviruses were constructed by GenePharma (Shanghai, China). Matrigel was purchased from BD Biosciences (Franklin Lakes, NJ, USA).

Immunohistochemistry (IHC)

Clinical tissue samples were processed following standard protocols.

• For fixation, dehydration, and embedding, tissues were fixed in 4% paraformaldehyde, dehydrated through a graded ethanol series, and embedded in paraffin.
• For sectioning and slide preparation, paraffin blocks were trimmed, and serial sections were cut.
• For staining, deparaffinization and rehydration were performed sequentially, followed by antigen retrieval via heat treatment. Sections were incubated with primary antibodies overnight at 4 ℃ and then with secondary antibodies at room temperature. Color development was conducted with a chromogenic substrate, and images were captured for scoring. All sections were independently evaluated in a blinded manner by two pathologists (a score ≥4 was considered positive, and a score <4 was considered negative).

Cell culture and VEGFA RNA interference

Human CRC cell lines (RKO and SW620) and human umbilical vein endothelial cells (HUVECs) were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in complete DMEM supplemented with FBS in a humidified incubator at 37 ℃ with 5% CO₂. When cell confluence reached 70–80%, CRC cells were transfected with VEGFA-specific short hairpin RNA (shRNA) lentiviral vectors (GV287) or negative control (shNC) vectors for gene knockdown. The medium was replaced 6 h after transfection, and stable cell lines were generated through selection with 1 µg/mL puromycin for 3 days. The sequences of VEGFA shRNAs (5'-3') were as follows:

• shVEGFA#1 forward, CTACGTTCAGATGTCGGATAT; shVEGFA#1 reverse, ACTGUUTUCACGUUGGCCGTT;
• shVEGFA#2 forward, AGTTTGCCCTC ACGCTTACAT; shVEGFA#2 reverse, UUGTACGUCACGUCGCUGCTT;
• shVEGFA#3 forward, AGTTGCCTACTTCGCTTCACTA; shVEGFA#3 reverse, UATCUCGGCAGGCUUCUCATA;
• shNC forward, TGCUCUGTCCGUGUGACGUAT; and shNC reverse, ATGUGUTTCGUUGUGAGAATU.

Western blotting

Proteins were extracted from cells and tissues, and protein concentrations were determined via a bicinchoninic acid assay. Equal amounts of protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto 0.45 µm polyvinylidene fluoride membranes. Membranes were blocked with 5% nonfat milk for 60 min at room temperature and then incubated with primary antibodies overnight at 4 ℃. After three washes, membranes were incubated with secondary antibodies for 90 min at room temperature with shaking. Protein signals were detected with an enhanced chemiluminescence kit.

Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was extracted, and its concentration and purity were measured. Complement DNA was synthesized via reverse transcription. qRT-PCR was performed via TB Green Premix Ex Taq (Takara Bio, Kusatsu, Japan), with GAPDH serving as the internal reference gene, according to the manufacturer’s instructions. Relative messenger RNA (mRNA) expression levels were calculated via the 2^−ΔΔCt method. The primer sequences (5'-3') were as follows:

• CD31 forward, TGCGATCTTCTGAACGCAGGT; CD31 reverse, CGAGCTTGGTCTAATTGAATT;
• VEGFA forward, TGTTATCGCTTAAGTCAGGT; VEGFA reverse, CGTAGTTGTCTCGTTGACTA;
• MKI67 forward, CGAGTCGGTCGATCGAATT; MKI67 reverse, AGAGACCGTCTATATGCATT;
• GAPDH forward, GAGATTTATGACAACCTCCCGTG; GAPDH reverse, GCCATTACGCTCACACCGTTT.

ELISA

Serum samples were collected from 40 patients with CRC (as described above) and 40 age-matched healthy controls and then stored at −80 ℃. Levels of soluble S1P and CD31 in serum supernatants were detected via commercial ELISA kits. According to the manufacturer’s protocols, 50 µL of supernatant was added to each well, and incubation, washing, and enzyme conjugation steps were completed. The optical density values were measured at 450 nm using a microplate reader.

Cell Counting Kit-8 (CCK-8) assay

Cells were seeded into 96-well plates at a density of 3.0×10³ cells/well and treated according to the experimental design (RKO and SW620 cells were cultured with S1P at concentrations of 0, 25, 50, 100 and 200 nmol/L for 24 hours, and treated with 100 nmol/L S1P for 12, 24, 36 and 48 hours, respectively). After the indicated incubation periods, 10 µL of CCK-8 reagent was added to each well, and the plates were incubated for 1 h at 37 ℃. Optical density values were measured at 450 nm with a microplate reader to assess cell viability.

Colony formation assay

CRC cells were seeded into six-well plates at a density of 1.0×10³ cells/well and cultured for 2 weeks, with medium changes performed every 3 days to prevent contamination. Colonies were photographed and counted under a light microscope.

Wound-healing assay

Cells were seeded into six-well plates at a density of 2.0×10⁵ cells/well and cultured until confluent monolayers formed. A sterile 200 µL pipette tip was used to create uniform vertical scratches across the cell monolayers. Fresh medium was added, and cells were cultured for the indicated time (0, 24 hours). Images were captured randomly from five fields per well with an inverted fluorescence microscope. Wound closure rates were calculated via ImageJ software (US National Institutes of Health, Bethesda, MD, USA).

Transwell migration and invasion assays

For migration assays, 1.0×10⁴/cells suspended in 0.2 mL of serum-free DMEM were added to the upper chamber of Transwell inserts. The lower chamber was filled with 0.6 mL of complete DMEM. After 24 h of incubation at 37 ℃ with 5% CO₂, cells remaining in the upper chamber were removed with cotton swabs. Cells that had migrated to the lower surface of the inserts were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet. For invasion assays, the upper chambers were precoated with 50 µL of Matrigel and incubated for 1 h at 37 ℃ before cells were seeded; the other steps were identical to those of the migration assay. Stained cells were photographed and counted from five random fields per insert, and the average number was calculated.

Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay for apoptosis

Cells were seeded into six-well plates at a density of 2.0×10⁵ cells/well and treated with the 100 nmol/L S1P. After the treatment period, apoptotic cells were detected with a TUNEL assay kit according to the manufacturer’s instructions. This kit was purchased from Beyotime Biotechnology (Shanghai) Co., Ltd. (Cat. No. C1086; Shanghai, China). The operating procedures are as follows: (I) wash the cells three times with PBS, then fix the cells with 4% paraformaldehyde for 30 min; (II) add PBS containing 0.3% Triton X-100 and incubate at room temperature for 5 min; (III) add 100 µL TUNEL detection solution, and incubate at 37 ℃ in the dark for 60 min; (IV) wash three times with PBS, mount the slides with anti-fade mounting medium, and observe under a fluorescence microscope. Images were captured from five random fields per well with an inverted fluorescence microscope, and apoptotic cells were counted to calculate the apoptosis rate.

Tube formation assay

CRC cells were seeded into six-well plates at 2.0×10⁵ cells/well and cultured for 24 h, with fresh medium replaced regularly. Conditioned medium (CM) was collected from CRC cell cultures. HUVECs (1.0×10⁴ cells/well) were seeded into Matrigel-coated 96-well plates and cultured in CRC-derived CM at 37 ℃ with 5% CO₂ for 6 h. Tube formation was observed under an inverted fluorescence microscope, and images were captured from five random fields per well for quantitative analysis.

CRC mouse model

Female nude mice (4–5 weeks) were purchased from Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. (Hangzhou, China) and housed under specific pathogen-free conditions. Mice were randomly divided into two groups (n=5 per group). RKO cells (3.0×10⁶ cells/mouse) were subcutaneously injected into the axillary region of each nude mouse. Three days later, the experimental group received tail vein injections of S1P (15 mg/kg), while the control group received an equal volume of normal saline, with injections repeated every 3 days for a total of 5 times. Subcutaneous tumor volume was measured every 3 days (volume = length × width²/2). Fifteen days after tumor cell inoculation, mice were anesthetized with 0.7% sodium pentobarbital and euthanized by cervical dislocation. Tumors were excised, photographed, and weighed. All animal experiments were performed under a project license [Approval No. (2023)574; May 26, 2023] granted by the Animal Ethics Committee of Bengbu Medical University, in compliance with the Basel Declaration (reference No. 2010), relevant institutional guidelines and governmental regulations for the care and use of animals. A protocol was prepared before the study but not registered in any database.

Statistical analysis

All data were analyzed using GraphPad Prism 9.0 software (Dotmatics, Boston, MA, USA) and ImageJ software. Statistical significance was determined via one-way analysis of variance or the unpaired Student t-test, as appropriate. A P<0.05 was considered statistically significant. All experiments were performed in triplicate.

Results

S1P was positively correlated with blood microvessel density (MVD) in CRC

Platelet endothelial cell adhesion molecule-1 (CD31), a transmembrane protein mainly expressed by endothelial cells and various hematopoietic cells, is commonly used as a sensitive and specific marker for MVD (25). IHC was performed to detect the expression of CD31 in 40 pairs of CRC tissues and matched adjacent noncancerous colorectal tissues. The results showed that the positive staining intensity of CD31 was markedly higher in CRC tissues than in noncancerous tissues (Figure 1A). Consistent with this, the integrated staining score of CD31 was significantly upregulated in CRC tissue sections (Figure 1B). Moreover, qRT-PCR revealed that the mRNA expression level of CD31 was significantly increased in cancer tissues (Figure 1C). In addition, serum samples were collected from the aforementioned 40 patients with CRC and 40 healthy individuals undergoing physical examination during the same period. According to ELISA, serum S1P and CD31 levels were significantly elevated in patients with CRC (Figure 1D,1E). Further statistical analysis indicated a significant positive correlation between the relative expression levels of S1P and CD31 (Figure 1F). VEGFA is a potent angiogenic factor that binds to VEGF receptors on tumor endothelial cells and promotes tumor progression (26). Western blotting was used to measure the protein expression of VEGFA in six pairs of CRC and matched adjacent nontumor tissues. The results showed that VEGFA protein levels were significantly higher in tumor tissues than in adjacent nontumor tissues (Figure 1G). In line with this, qRT-PCR also revealed a marked increase in VEGFA mRNA expression in CRC tissues (Figure 1H).

Figure 1 Correlation between serum S1P and tumor angiogenesis in patients with CRC. (A) IHC staining of CD31 in tumor tissues and matched normal tissues from 40 patients with CRC. (B) IHC score of CD31. (C) mRNA expression of CD31 in tissues as detected by qRT-PCR. (D,E) Serum levels of S1P and CD31 as measured by ELISA. (F) Correlation analysis of the relative expression levels of S1P and CD31. (G) Protein expression of VEGFA in tissues as detected by Western blotting. (H) mRNA expression of VEGFA in tissues as detected by qRT-PCR. Data are presented as mean ± SEM. **, P<0.01; ***, P<0.001. CD31, platelet endothelial cell adhesion molecule-1; CRC, colorectal cancer; ELISA, enzyme-linked immunosorbent assay; IHC, immunohistochemistry; mRNA, messenger RNA; N, node; qRT-PCR, quantitative real-time polymerase chain reaction; S1P, sphingosine-1-phosphate; SEM, standard error of the mean; T, tumor; VEGFA, vascular endothelial growth factor A.

Collectively, these clinical data indicate that upregulation of S1P is closely associated with tumor angiogenesis in patients with CRC.

S1P promoted the biological behaviors of CRC cells

It has been reported that S1P in the tumor microenvironment promotes cancer cell proliferation, invasion, and tumor metastasis (27). To investigate the phenotypic effects of S1P on CRC cells, we performed a series of in vitro functional assays.

Following treatment with various concentrations of S1P, CCK-8 assays showed that the proliferative activity of RKO and SW620 cells was significantly increased, with the optimal proliferative response observed at 100 nmol/L of S1P (this concentration was used in subsequent experiments) (Figure 2A). Meanwhile, the proliferation of RKO and SW620 cells increased in a time‑dependent manner (Figure 2B). These results demonstrated that S1P promotes CRC cell proliferation in a dose- and time-dependent manner. Furthermore, colony formation assays revealed that the number of colonies was markedly increased in S1P-treated CRC cells compared with the control group (Figure 2C). Wound-healing assays showed that the migration rate was significantly upregulated in the S1P group (Figure 2D). Transwell assays indicated that S1P dramatically enhanced the invasive capacity of CRC cells (Figure 2E). TUNEL assays indicated that S1P inhibited apoptosis in CRC cells (Figure 2F). In addition, CRC cells were cotreated with fingolimod hydrochloride (FTY720, an S1P antagonist) (28) and S1P. The invasive ability of cells in the S1P group was significantly enhanced compared with the S1P + FTY720 group (Figure 2G).

Figure 2 S1P promoted the biological behaviors of CRC cells. (A,B) Proliferative activity of RKO and SW620 cells as detected by CCK-8 assay. (C) Proliferative capacity of RKO and SW620 cells examined by colony formation assay (crystal violet staining). (D) Migration ability of RKO and SW620 cells as detected by wound-healing assay (magnification 40×). (E) Invasion of RKO and SW620 cells after 24 h as assessed by Transwell assay (magnification 200×; crystal violet staining). (F) Apoptosis of RKO and SW620 cells after 24 h as detected by TUNEL assay (magnification 200×; TUNEL fluorescent staining). (G) Invasion of RKO and SW620 cells after 24 h according to Transwell assay (magnification 200×; crystal violet staining). The concentration of S1P and FTY720 was 100 and 20 nmol/L, respectively. Data are presented as the mean ± SEM. *, P<0.05; **, P<0.01; ***, P<0.001. CCK-8, Cell Counting Kit-8; CRC, colorectal cancer; FTY720, fingolimod; OD, optical density; S1P, Sphingosine-1-phosphate; SEM, standard error of the mean; TUNEL, terminal deoxynucleotidyl transferase dUTP nick end labeling.

Collectively, these data indicate that S1P significantly promotes the malignant phenotypes of CRC cells.

S1P activated the STAT3 signaling pathway in CRC cells and tube formation

According to the Search Tool for Interacting Chemicals (STITCH) database (http://stitch.embl.de), S1P may regulate VEGFA expression via the STAT3 signaling pathway (Figure 3A). Thus, we further investigated whether S1P modulates the STAT3-VEGFA signaling axis in CRC cells. Compared with the control condition, S1P treatment significantly upregulated the protein level of p-STAT3 in RKO and SW620 cells, but there was no obvious change in the total STAT3 protein level (Figure 3B,3C); meanwhile, the expression of VEGFA was significantly increased (Figure 3D,3E). Notably, VEGFA is a well-characterized transcriptional target of the STAT3 signaling pathway (21,22). In addition, HUVECs were cultured with the CM from S1P-treated or untreated RKO and SW620 cells. It was consequently found that S1P can promote the in vitro tube formation of HUVECs (Figure 3F).

Figure 3 S1P activated the STAT3 signaling pathway in CRC cells and tube formation. (A) Correlation between S1P and STAT3/VEGFA expression according to the STITCH database. (B,C) STAT3 protein levels in RKO and SW620 cells treated with S1P (100 nmol/L) for 24 h as detected by Western blotting. (D,E) VEGFA protein levels in CRC cells treated with S1P (100 nmol/L) and FTY720 (20 nmol/L) for 24 h as detected by Western blotting. (F) In vitro tube formation of HUVECs cultured with CM from RKO and SW620 cells for 6 h (scale bar: 100 μm). Data are presented as the mean ± SEM. **, P<0.01; ***, P<0.001. CM, conditioned medium; CRC, colorectal cancer; FTY720, fingolimod; HUVECs, human umbilical vein endothelial cells; S1P, sphingosine-1-phosphate; SEM, standard error of the mean; STAT3, signal transducer and activator of transcription 3; STITCH, Search Tool for Interacting Chemicals; VEGFA, vascular endothelial growth factor A.

VEGFA knockdown attenuated the S1P-mediated promotion of migration and invasion in CRC cells

To further investigate whether the protumor effects of S1P on CRC cells are mediated via the STAT3/VEGFA signaling pathway, we treated CRC cells with TPCA (a specific inhibitor of the STAT3 pathway) (29,30). As expected, inhibition of STAT3 signaling significantly downregulated the expression of MKI67 and VEGFA in RKO cells (Figure 4A,4B) and in SW620 cells (Figure 4C,4D).

Figure 4 VEGFA knockdown attenuated the S1P-mediated promotion of migration and invasion in CRC cells. (A,C) Protein expression in RKO and SW620 cells treated with S1P (100 nmol/L) and TPCA (1 μmol/L) for 24 h as analyzed by Western blotting. (B,D) mRNA levels in RKO and SW620 cells treated with S1P (100 nmol/L) and TPCA (1 μmol/L) for 24 h as detected by qRT-PCR. (E,F) Migratory and invasive capacities of S1P-treated RKO and SW620 cells with VEGFA knockdown at 24 h as assessed by Transwell assay (magnification 200×; crystal violet staining). Data are presented as the mean ± SEM. *, P<0.05; **, P<0.01; ***, P<0.001. CRC, colorectal cancer; MKI67, marker of proliferation KI-67; mRNA, messenger RNA; qRT-PCR, quantitative real-time polymerase chain reaction; S1P, sphingosine-1-phosphate; SEM, standard error of the mean; TPCA, 2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide; VEGFA, vascular endothelial growth factor A.

Subsequently, we generated stable VEGFA-knockdown RKO and SW620 cell lines via lentiviral transduction (shVEGFA#1) following preliminary experiments, and these cell lines were used for subsequent assays. Transwell migration and invasion assays revealed that VEGFA knockdown markedly abrogated the S1P-induced enhancement of migratory and invasive capacities in CRC cells (Figure 4E,4F).

STAT3 signaling pathway was involved in S1P-induced angiogenesis in vitro

Angiogenesis is a critical prerequisite for multiple malignant biological behaviors of solid tumors, including tumor growth and metastasis (16). Our previous findings indicated that S1P activates the expression of p-STAT3 and VEGFA proteins and promotes angiogenesis in vitro. To further elucidate the specific role of the STAT3 signaling pathway in S1P-induced angiogenesis, CRC cells were cotreated with S1P and TPCA, and the CM was collected to culture HUVECs. HUVECs cultured with CM from S1P and TPCA cotreated CRC cells exhibited a significant reduction in S1P-enhanced migratory capacity (Figure 5A,5B), and the S1P-induced invasive capacity of HUVECs was also markedly impaired (Figure 5C). Additionally, tube formation assays revealed that blockade of the STAT3 signaling pathway significantly abrogated the proangiogenic effect of S1P (Figure 5D).

Figure 5 STAT3 signaling pathway was involved in S1P-induced angiogenesis in vitro. (A,B) Migration of HUVECs cultured with CM from RKO and SW620 cells for 24 h as determined by wound-healing assay (magnification 200×). (C) Invasion of HUVECs cultured with CM from RKO and SW620 cells for 24 h as determined by Transwell assay (scale bar: 500 μm; crystal violet staining). (D) Tube formation of HUVECs cultured with CM from RKO and SW620 cells for 6 h as determined by tube formation assay (scale bar: 100 μm). Data are presented as the mean ± SEM. *, P<0.05; **, P<0.01; ***, P<0.001. CM, conditioned medium; HUVECs, human umbilical vein endothelial cells; S1P, sphingosine-1-phosphate; SEM, standard error of the mean; TPCA, 2-((aminocarbonyl)amino)-5-(4-fluorophenyl)-3-thiophenecarboxamide.

Collectively, these data indicate that the STAT3 signaling pathway is involved in S1P-induced angiogenesis in vitro.

S1P promoted tumor growth in vivo

To further clarify whether S1P contributes to tumorigenesis in vivo, a subcutaneous tumor xenograft model was established through the inoculation of RKO cells into mice (Figure 6A). S1P significantly promoted the growth of subcutaneous tumors (Figure 6B), with a marked increase in tumor volume (Figure 6C) and tumor weight (Figure 6D). Additionally, IHC was performed to detect the expression levels of various molecules in mouse tumor tissues. Compared with those in the control group, the staining levels of MKI67, p-STAT3, and VEGFA in tumor tissues from the S1P group were significantly upregulated (Figure 6E). In addition, Western blotting was used to further determine the protein levels of these molecules in tumor tissues. The expression of p-STAT3 was significantly upregulated in the S1P group, while there was no significant change in the total STAT3 protein level (Figure 6F). The protein expression of MKI67 and VEGFA was significantly increased (Figure 6G).

Figure 6 S1P promoted tumor growth in vivo. (A) Schematic diagram of the mouse subcutaneous tumor xenograft model (mouse images were provided by the SciDraw website). (B) Tumor size measured when nude mice were killed. (C) Tumor volume measured at different time points. (D) Tumor weight measured when nude mice were killed. (E) Expression levels of MKI67, p-STAT3, and VEGFA as detected by IHC (magnification 200× and 400×). (F,G) Expression levels of MKI67, p-STAT3, and VEGFA as detected by Western blotting. Data are presented as the mean ± SEM. **, P<0.01; ***, P<0.001. IHC, immunohistochemistry; MKI67, marker of proliferation KI-67; S1P, sphingosine-1-phosphate; SEM, standard error of the mean; STAT3, signal transducer and activator of transcription 3; VEGFA, vascular endothelial growth factor A.

Collectively, these data indicate that S1P may promote in vivo tumor growth by activating the STAT3/VEGFA signaling pathway.

Discussion

S1P is a key bioactive lipid generated via sphingolipid metabolism in vivo (31) and exerts critical functions in tumor biology by modulating intracellular signaling cascades to facilitate cancer cell proliferation (32). CD31, a transmembrane protein predominantly produced by endothelial cells and multiple hematopoietic lineages, is widely recognized to be a sensitive and specific biomarker for intratumoral MVD (25). In our study, IHC and qRT-PCR analyses significantly elevated CD31 expression in CRC tumor tissues. ELISA further demonstrated heightened circulating S1P and CD31 concentrations in the serum of patients with CRC, and in the correlation analyses, there was a strong positive association between their expression levels. VEGFA is a potent angiogenic cytokine that binds to endothelial VEGF receptors to drive malignant progression (26). Western blotting showed significantly higher VEGFA protein abundance in tumor lesions relative to paired adjacent nontumor tissues, consistent with elevated VEGFA mRNA expression indicated by qRT-PCR. Collectively, these clinical data indicate that circulating and tissue S1P levels are tightly correlated with tumor angiogenesis in patients with CRC. These observations align with our previous cellular and animal experimental results and lay a solid foundation for further clarifying the molecular mechanisms by which S1P modulates CRC progression.

According to epidemiological data, distant metastasis is a leading cause of high mortality among patients with CRC (33). Malignant metastasis is a complex multistage cascade, in which tumor cell proliferation, migration, and invasion constitute core functional steps (34). It has been reported that S1P drives migratory and invasive phenotypes in endometrial carcinoma (35) and cutaneous squamous cell carcinoma (36). In line with this, our functional assays confirmed that S1P boosts proliferation, migration, and invasion in CRC cells. In summary, our results reinforce the notion that S1P exerts an oncogenic function across multiple malignancies, clarify the mechanisms related to S1P-dependent regulatory networks, and represent novel mechanistic insights into CRC metastatic dissemination.

S1P acts as a lipid mediator in governing a variety of signaling pathways under pathological conditions (37). Our work focused specifically on the STAT3 cascade, and the regulatory effects of S1P on other signaling axes will be examined in our follow-up investigations. It has been confirmed that constitutive STAT3 activation contributes to the tumorigenesis of a number of cancers (38,39). For example, hyperactivated STAT3 signaling promotes migration, invasion, and angiogenesis in non-small cell lung cancer (40) and accelerates breast cancer progression (41). In our study, S1P triggered STAT3 pathway activation in CRC cells, as reflected by elevated p-STAT3 protein levels, but there were no significant changes in total STAT3 protein. VEGFA, an endothelial-specific angiogenic factor with robust proangiogenic activity (42), is a canonical transcriptional target downstream of activated STAT3 (21,22). Consistent with our cellular and clinical observations, pharmacological blockade of S1P signaling with FTY720 further confirmed that S1P upregulates VEGFA expression to stimulate in vitro angiogenesis.

Angiogenesis is necessary for the emergence of the core malignant phenotypes of solid tumors, including sustained tumor growth and metastatic spread (16). MKI67, a classic cellular proliferation marker, has been extensively applied in clinical practice for cancer diagnosis and prognostic stratification (43). In our study, treatment of RKO and SW620 CRC cells with the STAT3 inhibitor TPCA abolished S1P-mediated upregulation of MKI67 and VEGFA. Moreover, VEGFA knockdown markedly abrogated the enhanced migratory and invasive capacity induced by S1P in CRC cells. These findings suggest that the STAT3-VEGFA signaling axis mediates the S1P-driven malignant phenotypes of CRC cells. Further in vitro angiogenesis assays demonstrated that the pharmacological inhibition of STAT3 signaling largely offsets the proangiogenic capacity of S1P. Taken together, our functional data indicate that STAT3 signaling is required for S1P-induced angiogenesis. Overall, considering our clinical, cellular and xenograft data, we propose that S1P accelerates CRC progression by activating STAT3 signaling to trigger CRC tumor angiogenesis.

A previous study found that S1P elevates tumor necrosis factor-alpha (TNF-α) and interleukin-6 (IL-6) secretion to aggravate inflammation-associated lung cancer progression (44). In a mouse model study, suppression of SPHK1-mediated S1P synthesis alleviated liver metastasis and prolonged animal survival via the inhibition of inflammasome activation and interleukin-1 beta (IL-1β) release, a process that is coregulated by nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) and hypoxia-inducible factor 1-alpha (HIF-1α) signaling (45). Our work is the first to provide evidence that S1P activates the STAT3-VEGFA cascade to facilitate in vivo CRC xenograft growth. Consistent with this, IHC and Western blotting demonstrated that S1P treatment upregulates MKI67, p-STAT3, and VEGFA in tumor tissues. However, several limitations of this study should be acknowledged. First, all the in vivo data were derived from a limited number of xenograft tumor samples, which may compromise the generalizability of our findings. We plan to continuously monitor survival outcomes of patients with CRC and validate our conclusions in a larger independent clinical cohort. Second, given the complex upstream and downstream molecular network associated with S1P, other biological functions of S1P remain to be characterized in future work.

Conclusions

S1P in CRC samples is positively correlated with tumor angiogenesis. S1P activates the STAT3 signaling pathway to promote the malignant behaviors and angiogenesis of CRC cells in vitro and contributes significantly to tumor progression in vivo. Therefore, S1P may serve as a molecular marker for the clinical diagnosis of CRC metastasis.

Acknowledgments

The authors extend their gratitude to the research team for their help in this study.

Footnote

Reporting Checklist: The authors have completed the ARRIVE and MDAR reporting checklists. Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2026-0448/rc

Data Sharing Statement: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2026-0448/dss

Peer Review File: Available at https://jgo.amegroups.com/article/view/10.21037/jgo-2026-0448/prf

Funding: This work was supported by the Key Scientific Research Project of the Anhui Provincial Department of Education (Nos. 2025AHGXZK31426 and 2022AH052328), the Key Health and Medical Research Project of Anhui Province (No. AHWJ2022a003), and the Graduate Research Innovation Project of Bengbu Medical University (Nos. Byycx22090, Byycx24023, and Byycx25033).

Conflicts of Interest: All authors have completed the ICMJE uniform disclosure form (available at https://jgo.amegroups.com/article/view/10.21037/jgo-2026-0448/coif). The authors have no conflicts of interest to declare.

Ethical Statement: The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. The study was conducted in accordance with the Declaration of Helsinki and its subsequent amendments. The study was approved by the Ethics Committee of Bengbu Medical University [Bengbu, China; Approval No. (2023)311; May 26, 2023]. Written informed consent was obtained from each individual according to the Ethics Committee’s terms. All animal experiments were performed under a project license [Approval No. (2023)574; May 26, 2023] granted by the Animal Ethics Committee of Bengbu Medical University, in compliance with the Basel Declaration (reference No. 2010), relevant institutional guidelines and governmental regulations for the care and use of animals.

Open Access Statement: This is an Open Access article distributed in accordance with the Creative Commons Attribution-NonCommercial-NoDerivs 4.0 International License (CC BY-NC-ND 4.0), which permits the non-commercial replication and distribution of the article with the strict proviso that no changes or edits are made and the original work is properly cited (including links to both the formal publication through the relevant DOI and the license). See: https://creativecommons.org/licenses/by-nc-nd/4.0/.

References

1. Liu SC, Zhang H. Early diagnostic strategies for colorectal cancer. World J Gastroenterol 2024;30:3818-22. [Crossref] [PubMed]
2. Liu C, Lai P, Hu J, et al. Lactobacillus johnsonii Synthesizes Chenodeoxycholic Acid to Reduce Susceptibility to High-Fat Diet-Induced Colorectal Cancer. Cancer Res 2025;85:4600-15. [Crossref] [PubMed]
3. Romero-Ramos YM, Goedel W, Boudreau M, et al. Evaluation of colorectal cancer screening practices in Rhode Island, 2011-2021. Cancer Causes Control 2026;37:46. [Crossref] [PubMed]
4. Zhang X, Zhang X, Luo X, et al. CCL5 promotes colon cancer progression via PI3K/AKT signaling and is negatively regulated by STAT1. J Gastrointest Oncol 2026;17:65. [Crossref] [PubMed]
5. Powell JA, Pitson SM. Sphingosine 1-phosphate signalling in cancer stem cells. Oncogenesis 2025;14:42. [Crossref] [PubMed]
6. Wu F, Feng Z, Wang X, et al. Sphingosine-1-phosphate stimulates colorectal cancer tumor microenvironment angiogenesis and induces macrophage polarization via macrophage migration inhibitory factor. Front Immunol 2025;16:1564213. [Crossref] [PubMed]
7. Lu F, Wang G, Yang X, et al. SPHK1-S1p Signaling Drives Fibrocyte-Mediated Pulmonary Fibrosis: Mechanistic Insights and Therapeutic Potential. Pharmaceuticals (Basel) 2025;18:859. [Crossref] [PubMed]
8. Dong D, Yu X, Tao X, et al. S1P/S1PR1 signaling is involved in the development of nociceptive pain. Front Pharmacol 2024;15:1407347. [Crossref] [PubMed]
9. Weigel C, Bellaci J, Spiegel S. Sphingosine-1-phosphate and its receptors in vascular endothelial and lymphatic barrier function. J Biol Chem 2023;299:104775. [Crossref] [PubMed]
10. Liu H, Li X, Liu W, et al. DHRS2-induced SPHK1 downregulation contributes to the cell growth inhibition by Trichothecin in colorectal carcinoma. Biochim Biophys Acta Mol Cell Res 2024;1871:119846. [Crossref] [PubMed]
11. Yao X, Yuen T, Qingchuan C, et al. Melanophilin inhibit the growth and lymph node metastasis of triple negative breast cancer via the NONO-SPHK1-S1P axis. J Transl Med 2025;23:284. [Crossref] [PubMed]
12. Wang X, Guo W, Shi X, et al. S1PR1/S1PR3-YAP signaling and S1P-ALOX15 signaling contribute to an aggressive behavior in obesity-lymphoma. J Exp Clin Cancer Res 2023;42:3. [Crossref] [PubMed]
13. Noujarède J, Carrié L, Garcia V, et al. Sphingolipid paracrine signaling impairs keratinocyte adhesion to promote melanoma invasion. Cell Rep 2023;42:113586. [Crossref] [PubMed]
14. Morang S, Bisht M, Upadhyay V, et al. S1P Signaling Genes as Prominent Drivers of BCR-ABL1-Independent Imatinib Resistance and Six Herbal Compounds as Potential Drugs for Chronic Myeloid Leukemia. OMICS 2024;28:367-76. [Crossref] [PubMed]
15. Leslie AR, Ning S, Sharifi M, et al. IGFBP3-SphK1/S1P Signaling Axis Drives Enzalutamide Resistance in Advanced Prostate Cancer. Mol Cancer Ther 2026;25:786-98. [Crossref] [PubMed]
16. Yang X, Li W, Han X, et al. Apatinib weakens proliferation, migration, invasion, and angiogenesis of thyroid cancer cells through downregulating pyruvate kinase M2. Sci Rep 2024;14:879. [Crossref] [PubMed]
17. Lv S, Liu Y, Xie C, et al. Emerging role of interactions between tumor angiogenesis and cancer stem cells. J Control Release 2023;360:468-81. [Crossref] [PubMed]
18. Liu XT, Huang Y, Liu D, et al. Targeting the SphK1/S1P/PFKFB3 axis suppresses hepatocellular carcinoma progression by disrupting glycolytic energy supply that drives tumor angiogenesis. J Transl Med 2024;22:43. [Crossref] [PubMed]
19. Sun H, Hu B, Wu C, et al. Targeting the SPHK1/S1P/S1PR2 axis ameliorates GH-secreted pituitary adenoma progression. Eur J Clin Invest 2024;54:e14117. [Crossref] [PubMed]
20. Hu Y, Dong Z, Liu K. Unraveling the complexity of STAT3 in cancer: molecular understanding and drug discovery. J Exp Clin Cancer Res 2024;43:23. [Crossref] [PubMed]
21. Zhang Y, Zheng L, Feng AQ, et al. Targeting AKR1C1 overcomes lenvatinib resistance in hepatocellular carcinoma through the STAT3-ABC transporters pathway. J Gastrointest Oncol 2026;17:87. [Crossref] [PubMed]
22. Kim TH, Lee D, Oh HJ, et al. Cancer-associated fibroblast-derived GAS6 increases resistance to chemotherapy through AXL/STAT3/ABCG1 in gastric cancer. Br J Cancer 2026;134:72-84. [Crossref] [PubMed]
23. Kong J, Kong F, Gao J, et al. Correction: YC-1 enhances the anti-tumor activity of sorafenib through inhibition of signal transducer and activator of transcription 3 (STAT3) in hepatocellular carcinoma. Mol Cancer 2026;25:12. [Crossref] [PubMed]
24. Zhou W, Xu X, Zhu H, et al. Mechanism of triptolide in the treatment of gastric cancer with diabetes through JAK2/STAT3 pathway. Eur J Pharmacol 2026;1010:178404. [Crossref] [PubMed]
25. Fu T, Sullivan DP, Gonzalez AM, et al. Mechanotransduction via endothelial adhesion molecule CD31 initiates transmigration and reveals a role for VEGFR2 in diapedesis. Immunity 2023;56:2311-2324.e6. [Crossref] [PubMed]
26. Liu W, Duan W, Xia S, et al. CD146(+) pericyte-like lung cancer brain metastatic stem cells promote tumor angiogenesis through dual regulatory effects on the VEGF/VEGFR axis. Theranostics 2026;16:1905-24. [Crossref] [PubMed]
27. Wang Z, Wang X, Luo Q, et al. Qi-Huang decoction ameliorates renal injury in candidaemia via Dectin-1/NF-κB/IκBζ signaling pathway regulated by miR-32-5p. J Ethnopharmacol 2026;366:121671. [Crossref] [PubMed]
28. Patel SH, Bachmann M, Kadow S, et al. Simultaneous targeting of mitochondrial Kv1.3 and lysosomal acid sphingomyelinase amplifies killing of pancreatic ductal adenocarcinoma cells in vitro and in vivo. J Mol Med (Berl) 2023;101:295-310. [Crossref] [PubMed]
29. Huang Q, Xiao Y, Lan T, et al. WNT7A promotes tumorigenesis of head and neck squamous cell carcinoma via activating FZD7/JAK1/STAT3 signaling. Int J Oral Sci 2024;16:7. [Crossref] [PubMed]
30. Chen Y, Huang L, Gan RH, et al. IL-8 activates fibroblasts to promote the invasion of HNSCC cells via STAT3-MMP1. Cell Death Discov 2024;10:65. [Crossref] [PubMed]
31. Li H, Wang G, Fan Y, et al. Shengmai San attenuates irradiation-induced salivary gland injury and fibrosis by inhibiting the SPHK1-S1P-S1PR1 axis. Phytomedicine 2026;150:157742. [Crossref] [PubMed]
32. Song L, Xiong P, Jike A, et al. CircRAD18 promotes glioblastoma proliferation, migration and invasion via the miR‑1231/LUC7L2 axis. Int J Mol Med 2026;58:180. [Crossref] [PubMed]
33. Morgan E, Arnold M, Gini A, et al. Global burden of colorectal cancer in 2020 and 2040: incidence and mortality estimates from GLOBOCAN. Gut 2023;72:338-44. [Crossref] [PubMed]
34. Ruan Q, Wang C, Wu Y, et al. Exosome microRNA-22 inhibiting proliferation, migration and invasion through regulating Twist1/CADM1 axis in osteosarcoma. Sci Rep 2024;14:761. [Crossref] [PubMed]
35. Błachnio-Zabielska AU, Sadowska P, Chlabicz U, et al. Differential Effects of Sphingolipids on Cell Death and Antioxidant Defenses in Type 1 and Type 2 Endometrial Cancer Cells. Int J Mol Sci 2025;26:4472. [Crossref] [PubMed]
36. Park K, Shin KO, Kim YI, et al. Sphingosine-1-Phosphate-Cathelicidin Axis Plays a Pivotal Role in the Development of Cutaneous Squamous Cell Carcinoma. J Invest Dermatol 2025;145:854-863.e6. [Crossref] [PubMed]
37. Thomas N, Schröder NH, Nowak MK, et al. Sphingosine-1-phosphate suppresses GLUT activity through PP2A and counteracts hyperglycemia in diabetic red blood cells. Nat Commun 2023;14:8329. [Crossref] [PubMed]
38. Amara CS, Kami Reddy KR, Yuntao Y, et al. The IL6/JAK/STAT3 signaling axis is a therapeutic vulnerability in SMARCB1-deficient bladder cancer. Nat Commun 2024;15:1373. [Crossref] [PubMed]
39. Zhang J, Wang W, Liu X, et al. PDIA3 Inhibition Facilitates Sensitivity of IKE-Induced Ferroptosis via STAT3/LCN2 Axis to Improve Glioblastoma Therapy. Adv Sci (Weinh) 2026;13:e14191. [Crossref] [PubMed]
40. Jin X, Shang B, Wang J, et al. Farnesoid X receptor promotes non-small cell lung cancer metastasis by activating Jak2/STAT3 signaling via transactivation of IL-6ST and IL-6 genes. Cell Death Dis 2024;15:148. [Crossref] [PubMed]
41. Jiang M, Zhao Y, Ma Q, et al. Acetyltransferase p300 promotes NNK-induced colorectal cancer progression by mediating ANKHD1 expression via H3K27ac modification. Chem Biol Interact 2026;434:112111. [Crossref] [PubMed]
42. Álvarez-Vallina L, Sanz L. Anti-angiogenic therapies in cancer: from endogenous inhibitors to bispecific VEGF x PD-(L)1 antibodies. Front Immunol 2026;17:1736806. [Crossref] [PubMed]
43. Zhang Y, Zhou J, Strittmatter K, et al. Ki-67 promotes circulating tumor cell intravasation and metastasis in breast cancer. Cell Rep 2026;45:117354. [Crossref] [PubMed]
44. Terlizzi M, Colarusso C, Somma P, et al. S1P-Induced TNF-α and IL-6 Release from PBMCs Exacerbates Lung Cancer-Associated Inflammation. Cells 2022;11:2524. [Crossref] [PubMed]
45. Zhan Y, Xu J, Zhang Z, et al. Targeting SPHK1 in macrophages remodels the tumor microenvironment and enhances anti-PD-1 immunotherapy efficacy in colorectal cancer liver metastasis. Cancer Commun (Lond) 2025;45:1203-28. [Crossref] [PubMed]